Which of the following processes is related to reverse transcription?
1. DNA dependent DNA synthesis
2. RNA dependent DNA synthesis
3. DNA dependent RNA synthesis
4. RNA dependent polypeptide synthesis
Add Note
Subtopic: DNA Double Helix |
80%
Level 1: 80%+
Other Reason
Highlight in NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Upgrade Your Plan
Upgrade now and unlock your full question bank experience with daily practice.
If the sequence of bases in one of the DNA strand is A G G A G A A, then the sequence of bases in the other complementary strand of DNA would be
1. C C T T C T T
2. T C T C T C C
3. T C C T C T T
4. C C T C T C T
Add Note
Subtopic: DNA Replication | Transcription |
95%
Level 1: 80%+
Other Reason
Highlight in NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Upgrade Your Plan
Upgrade now and unlock your full question bank experience with daily practice.
Human genome project was closely associated with the rapid development of a new area in biology called _____.
1. Biotechnology
2. Bioinformatics
3. Biofortification
4. Microbiology
Add Note
Subtopic: Human Genome Project |
83%
Level 1: 80%+
Other Reason
Highlight in NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Upgrade Your Plan
Upgrade now and unlock your full question bank experience with daily practice.
If the sequence of one strand of DNA is 5' A T G C A T C G 3', find the sequence of complementary strand in 5' → 3' direction
1. T A C G T A G C
2. C G A T G C A T
3. A T G C A T C G
4. A T C G T A C G
Add Note
Subtopic: Transcription |
59%
Level 3: 35%-60%
Other Reason
Highlight in NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Upgrade Your Plan
Upgrade now and unlock your full question bank experience with daily practice.
Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation.
3'AUCAGGUUUGUGAUGGUACGA5'
1. Phenylalanine, Methionine
2. Cysteine, Glycine
3. Alanine, Proline
4. Serine, Valine
Add Note
Subtopic: Genetic Code |
71%
Level 2: 60%+
Other Reason
Highlight in NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Upgrade Your Plan
Upgrade now and unlock your full question bank experience with daily practice.
Select the important goals of HGP from the given options :
(i) Store the information for data analysis.
(ii) Cloning and amplification of human DNA.
(iii) Identify all the genes present in human DNA.
(iv) Use of DNA information to trace human history.
1. (i) and (ii)
2. (ii) and (iii)
3. (i) and (iii)
4. (ii) and (iv)
Add Note
Subtopic: Human Genome Project |
81%
Level 1: 80%+
Other Reason
Highlight in NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Upgrade Your Plan
Upgrade now and unlock your full question bank experience with daily practice.
The correct feature of double-helical structure of DNA as given by Watson and Crick is:
1. Right-handed helix, pitch is \(3.4~ \text {nm}\)
2. Left-handed helix, pitch is \(3.8~ \text {nm}\)
3. Right-handed helix, pitch is \(3.8~ \text {nm}\)
4. Left-handed helix, pitch is \(3.4~ \text {nm}\)
Add Note
Subtopic: DNA Double Helix |
92%
Level 1: 80%+
Other Reason
Highlight in NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Upgrade Your Plan
Upgrade now and unlock your full question bank experience with daily practice.
Charging of tRNA during translation is necessary for :
1. Binding of anticodons of tRNA to the respective codons of mRNA.
2. Peptide bond formation between two amino acids.
3. Movement of ribosomes from codon to codon.
4. Binding of ribosomes to the mRNA.
Add Note
Subtopic: Translation |
59%
Level 3: 35%-60%
Other Reason
Highlight in NCERT
Please attempt this question first.
Hints
Please attempt this question first.
Upgrade Your Plan
Upgrade now and unlock your full question bank experience with daily practice.