NEET 2023 Exam Paper

Physics - Section A

1.

Which of the following is the largest constituent of the membrane of the erythrocyte in human beings and is also responsible for performing most of the functions of the membrane?
1. Protein
2. Lipid
3. Glycolipid
4. Glycoprotein

2.

Prokaryotic mesosomes do not help in:
1. Cell wall formation
2. DNA replication
3. Respiration
4. Photosynthesis

3.

The outer membrane of the nucleus:
I. is continuous with the Endoplasmic reticulum
II. does not bear ribosomes.
1. Only I is correct
2. Only II is correct
3. Both I and II are correct
4. Both I and II are incorrect

4.

All of the following are nucleosides, except:

1.	Adenosine	2.	Cytosine
3.	Guanosine	4.	Uridine

5.

Identify the incorrect statement regarding the structure of proteins:

1.	They are heteropolymers containing strings of amino acids.
2.	The first amino acid in the primary structure is the N-terminus amino acid
3.	Only left helices are observed in proteins
4.	Tertiary structure is absolutely essential for many biologic functions of the proteins

6.

The beginning of diplotene is recognized by:
1. appearance of recombination nodules
2. crossing over
3. dissolution of synaptonemal complex
4. appearance of chiasmata

7.

In an average composition of a cell, the maximum % of total cellular mass [after water and protein] is constituted by:
1. Carbohydrates
2. Lipid
3. Nucleic acids
4. Ions

8.

Identify the option, where all the columns are not matched correctly:

1.	Abrin	Secondary metabolite	Drug
2.	GLUT-4	Protein	Transport carrier
3.	Lecithin	Phospholipid	Cell membrane
4.	Thymidylic Acid	Nucleotide	DNA

9.

A feature unique to prokaryotes would be:
1. A cell wall not made up of cellulose
2. An extrachromosomal plasmid DNA
3. A cell membrane of peptidoglycan
4. Presence of inclusions

10.

The six most common atoms in organic molecules are:

1.	Carbon, Hydrogen, Oxygen, Helium, Calcium and Sulphur
2.	Carbon, Hydrogen, Oxygen, Calcium, Magnesium and Sulphur
3.	Carbon, Oxygen, Nitrogen, Sulphur, Phosphorous and Magnesium
4.	Carbon, Hydrogen, Oxygen, Nitrogen, Phosphorous and Sulphur

11.

The following cell undergoing mitosis, is at:

1.	Early prophase	2.	Late prophase
3.	Transition to metaphase	4.	Early metaphase

12.

Identify the correct statement regarding the part of cell, the structure of which is shown in the given diagram:

1. It is not found in the plant cells
2. It serves to provide an attachment with a surface for a bacterial cell
3. The structure is made of a protein called flagellin
4. It can be used for movement by a eukaryotic cell

13.

Select the mismatch:

Column I		Column II
1.	Gas vacuoles	Green bacteria Cells
2.	Large central vacuoles	Animal cells
3.	Protists	Eukaryotes
4.	Methanogens	Prokaryotes

14.

Select the wrong statement:

1.	Bacterial cell wall is made up of peptidoglycan
2.	Pili and fimbriae are mainly involved in the motility of bacterial cells
3.	Cyanobacteria lack flagellated cells
4.	Mycoplasma is a wall-less microorganism

15.

Which of the following is true for nucleolus?

1. Larger nucleoli are present in dividing cells.
2. It is a membrane-bound structure.
3. It takes part in spindle formation.
4. It is a site for active ribosomal RNA synthesis.

16.

Which one of the following statements is incorrect?
1. Cellulose is a polysaccharide
2. Uracil is a pyrimidine
3. Glycine is a sulphur-containing amino acid
4. Sucrose is a disaccharide

17.

Arrange the following events of meiosis in a correct sequence:
I. Crossing over
II. Synapsis
III. Terminalisation of chiasmata
IV. Disappearance of nucleolus

1.	II, I, IV, III	2.	II, I, III, IV
3.	I, II, III, IV	4.	II, III, IV, I

18.

Match the following column I with column II.

Column I	Column II
A. Synapsis aligns homologous chromosomes	(i) Anaphase II
B. Synthesis of RNA and protein	(ii) Zygotene
C. Action of enzyme recombinase	(iii) G₂ - phase
D. Centromeres do not separate, but chromatids move towards opposite poles	(iv) Anaphase I
	(v) Pachytene

1. A-(ii) B-(i) C-(iii) D-(iv)
2. A-(ii) B-(iii) C-(v) D-(iv)
3. A-(i) B-(ii) C-(v) D-(iv)
4. A-(ii) B-(iii) C-(iv) D-(v)

19.

Which of the following structures performs the function of mitochondria in a bacteria?

1.	Nucleoid	2.	Ribosomes
3.	Cell wall	4.	Mesosomes

20.

An alkene "A" on reaction with $O_{3}$ and $Zn - H_{2} O$ gives propanone and ethanal in equimolar ratio. The addition of HCl to alkene "A" gives "B" as the major product. The structure of product "B" is:
1.
2.
3.
4.

21.

Which of the following statements is not correct?

1.	Lysosomes are formed by the process of packaging in the endoplasmic reticulum.
2.	Lysosomes have numerous hydrolytic enzymes
3.	The hydrolytic enzyme of lysosomes are active under acidic pH
4.	Lysosomes are membrane bound structure.

22.

In a sinusoidal wave, the time required for a particular point to move from maximum displacement to zero displacement is $0.170$ s. The frequency of the wave is:

1.	$1.47$ Hz	2.	$0.36$ Hz
3.	$0.73$ Hz	4.	$2.94$ Hz

23.

Non-membranous nucleoplasmic structures in the nucleus, are the sites for active synthesis of:

1.	protein	2.	mRNA
3.	rRNA	4.	tRNA

24.

Prosthetic groups differ from co-enzymes, in which:

1.	they require metal ions for their activity.
2.	they (prosthetic groups) are tightly bound to apoenzymes.
3.	their association with apoenzymes is transient.
4.	they can serve as co-factors in a number of enzyme-catalyzed reactions.

25.

Correct statement/s about organic isomers is /are -

a.	They have the same molecular formula.
b.	Their physical properties are very similar.
c.	They have a different structural formula.

1. a and b only.
2. a, b and c.
3. b and c only.
4. a and c only.

26.

The most reactive compound among the following towards electrophilic substitution reaction is:

1.		2.
3.		4.

27.

The phase difference between velocity and displacement in a simple harmonic motion is:
1. $\pi$
2. $\frac{\pi}{2}$
3. $\frac{\pi}{4}$
4. zero

28.

The displacement of an object attached to a spring and executing simple harmonic motion is given by $x = 4~\mathrm{cos\pi t}$ meters. The time at which the maximum magnitude of acceleration occurs first after the start is:
1. $0.5$ s
2. $1$ s
3. $2$ s
4. $1.5$ s

29.

Displacement as a function of time is given as $y=2sin \omega t+2cos \omega t.$ The amplitude of the function is:

1.	$2\sqrt{2}$	2.	$2$
3.	$4$	4.	$8$

30.

The displacement $ x$ of a particle varies with time $t$ as $x = A sin\left (\frac{2\pi t}{T} +\frac{\pi}{3} \right)$. The time taken by the particle to reach from $x = \frac{A}{2} $ to $x = -\frac{A}{2} $ will be:

1.	$\frac{T}{2}$	2.	$\frac{T}{3}$
3.	$\frac{T}{12}$	4.	$\frac{T}{6}$

31.

A body of mass $20$ g is executing SHM with amplitude $5$ cm. When it passes through the equilibrium position its speed is $20$ cm/s. What would be the distance from equilibrium when its speed becomes $10$ cm/s?
1. $\frac{5\sqrt{3}}{4}$ cm
2. $\frac{5\sqrt{3}}{2}$ cm
3. $\frac{25\sqrt{7}}{2}$ cm
4. $5\sqrt{3}$ cm

32.

The displacement $(\mathrm{x})$ of an SHM varies with time $(\mathrm{t})$ as shown in the figure. The frequency of variation of potential energy is:

1.	$5$ Hz	2.	$10$ Hz
3.	$40$ Hz	4.	$20$ Hz

33.

A particle performs SHM with frequency $f.$ The frequency of its velocity and acceleration are respectively:
1. $f,~f$
2. $\frac{f}{2},~f$
3. $2f,~f$
4. $f,~2f$

34.

Force acting on a body free to move on the $\mathrm{X}$-axis is given by, $F=-kx^n$ where $k$ is a positive constant. For which value of $n$ motion of the body is not oscillatory?

1.	$3$	2.	$7$
3.	$2$	4.	$5$

35.

The hybridization of carbon atoms in the following compound from left to right is:

1. sp², sp³, sp², sp², sp
2. sp², sp², sp², sp², sp
3. sp³, sp², sp², sp², sp²
4. sp³, sp², sp², sp², sp

Physics - Section B

36.

Which of the following would not be true for a typical plant cell?
1. A cell wall composed of cellulose, hemicelluloses, and pectin.
2. A large vacuole that regulates turgor pressure.
3. The absence of flagella or centrioles, except in the gametes.
4. A freely permeable cell membrane.

37.

The end product (B) in the given reaction is:

1.
2.
3.
4.

38.

Identify the correct statement regarding the structure of a molecule shown in the given diagram:

I. It is an alpha amino acid
II. The configuration shown is called zwitterion
1. Only I
2. Only II
3. Both I and II
4. Neither I nor II

39.

The molecule shown in the given diagram:

I. is a lipid.
II. is biosynthesized from acetyl coA.
III. is a precursor of steroid hormones in animals.
1. Only I and II are correct
2. Only I and III are correct
3. Only II and III are correct
4. I, II and III are correct

40.

What is incorrect regarding the double helix model of DNA given by Watson and Crick?

1.	At each step of ascent the strand turns	36⁰
2.	The pitch	3.4 nm
3.	The rise per base pair	0.34 nm
4.	Diameter	10 nm

41.

Identify the incorrect statement regarding glycogen:
1. It is a homopolymer of alpha glucose molecules
2. It is the preferred storage carbohydrate in animals
3. The left hand of the molecule is called, the reducing end
4. It has α [1→ 6] branching

42.

Which stage of the mitotic division in a cell shown in the options depicts a ‘transition’ to metaphase?

1.		2.
3.		4.

43.

During cytokinesis:

I:	A cleavage furrow forms in the center of the animal cell and extends to the periphery
II.	A cell plate is formed at the periphery in plant cells and deepens towards the center

1. Only I is correct
2. Only II is correct
3. Both I and II are correct
4. Both I and II are incorrect

44.

Identify the incorrect statement:

1.	In an animal cell, the steroidal hormones are synthesized in SER.
2.	The sarcoplasmic reticulum is a type of rough endoplasmic reticulum.
3.	The cis and trans faces of Golgi are entirely different but interconnected.
4.	Lysosomes contain acid hydrolases.

45.

Identify the correct statement with regard to $G_{1}$ phase (Gap 1) of interphase:

1.	The reorganisation of all cell components takes place.
2.	The cell is metabolically active and grows but does not replicate its DNA
3.	Nuclear division takes place
4.	DNA synthesis or replication takes place.

46.

Which of the following statements about inclusion bodies is incorrect?
1. These are involved in the ingestion of food particles.
2. They lie freely in the cytoplasm.
3. These represent reserve material in cytoplasm.
4. They are not bound by any membrane.

47.

The hydrocarbons having the lowest dipole moment among the following is:
1.
2. CH₃ - C ≡ C - CH₃
3. CH₃ CH₂ CH = CH₂
4. CH₂ = CH - C ≡ CH

48.

The figure depicts four $(\mathrm{x-t})$ plots for the linear motion of a particle.

(a)

(b)
(c)
(d)

Which of the following is true?

1.	(a) is periodic but (c) is not periodic.
2.	(b) is periodic but (d) is not periodic.
3.	(b) and (d) are periodic.
4.	only (c) is periodic.

49.

The aromatic compound among the following is:

1.		2.
3.		4.

50.

Arrange the following hydrogen halides in order of their increasing reactivity with propene:
1. HCl > HBr > HI
2. HBr > HI > HCl
3. HI > HBr > HCl
4. HCl > HI > HBr

Chemistry - Section A

51.

The size of Pleuro Pneumonia Like Organism (PPLO) is:
1. 0.02 $μ$ m
2. 1-2 $μ$ m
3. 10-20 $μ$ m
4. 0.1 $μ$ m

52.

The possible number of distinct terminal alkynes are possible for a compound having molecular formula C₅H₈is:
1. 1
2. 2
3. 3
4. 4

53.

Which of the following pairs represent isomers?
1. CH₃−CH₃, CH₃−CH₂−CH₃
2. H₂C=CH−OH , CH₃−O−CH₃
3.
4. All of the above.

54.

In an electrophilic substitution reaction of nitrobenzene, the presence of nitro group:

(a)	Deactivates the ring by inductive effect.
(b)	Activates the ring by inductive effect.
(c)	Decreases the charge density at ortho and para position of the ring relative meta position by resonance.
(d)	Increases the charge density at meta position relative to the ortho and para positions of the ring by resonance.

Choose the correct option:
1. (a, b)
2. (b, c)
3. (c, d)
4. (a, c)

55.

The increasing order of nucleophilicity of the following nucleophiles is:

(a)	$C H_{3} C O_{2}^{⊝}$
(b)	H₂O
(c)	$C H_{3} S O_{3}^{⊝}$
(d)	$\overset{⊝}{O} H$

1.	(b) < (c) < (a) < (d)	2.	(b) < (c) < (d) < (a)
3.	(a) < (d) < (c) < (b)	4.	(d) < (a) < (c) < (b)

56.

Following are the statements with reference to 'lipids'.

(a)	Lipids having only single bonds are called unsaturated fatty acids.
(b)	Lecithin is a phospholipid.
(c)	Trihydroxy propane is glycerol.
(d)	Palmitic acid has 20 carbon atoms including carboxyl carbon.
(e)	Arachidonic acid has 16 carbon atoms.

You have to choose the correct statements out of the five given above. Choose the correct answer from the options given below:
1. (b) and (c) only
2. (b) and (e) only
3. (a) and (b) only
4. (c) and (d) only

57.

If the time period of a $2$ m long simple pendulum is $2$ s, the acceleration due to gravity at the place where the pendulum is executing simple harmonic motion is:
1. $\pi^{2}$ m/s²
2. $2\pi^{2}$ m/s²
3. $9.8$ m/s²
4. $16$ m/s²

58.

An object of mass $m$ is suspended at the end of a massless wire of length $L$ and area of cross-section $A.$ Young modulus of the material of the wire is $Y.$ If the mass is pulled down slightly, its frequency of oscillation along the vertical direction is:
1.   $f = \frac{1}{2 π} \sqrt{\frac{m A}{Y L}}$
2.   $f = \frac{1}{2 π} \sqrt{\frac{Y L}{m A}}$
3.   $f = \frac{1}{2 π} \sqrt{\frac{m L}{Y A}}$
4.   $f = \frac{1}{2 π} \sqrt{\frac{Y A}{m L}}$

59.

The time period of a particle in simple harmonic motion is equal to the time between consecutive appearances of the particle at a particular point in its motion. This point is:

1.	the mean position
2.	an extreme position
3.	between the mean position and the positive extreme
4.	between the mean position and the negative extreme

60.

A wall clock uses a vertical spring-mass system to measure the time. Each time the mass reaches an extreme position, the clock advances by a second. The clock gives correct time at the equator. If the clock is taken to the poles it will:

1.	run slow	2.	run fast
3.	stop working	4.	give correct time

61.

A particle is fastened at the end of a string and is whirled in a vertical circle with the other end of the string being fixed. The motion of the particle is:

1.	periodic
2.	oscillatory
3.	simple harmonic
4.	angular simple harmonic

62.

Which of the following quantities are always zero in a simple harmonic motion?

a.	$\vec{F} \times \vec{a}~~~~~~~$
b.	$\vec{v} \times\vec{r}$
c.	$\vec{a} \times\vec{r}$
d.	$\vec{F} \times\vec{r}$

Choose the correct option:

1.	(a) and (b)
2.	(a), (b) and (c)
3.	(b), (c) and (d)
4.	all of these

63.

Which of the following equations represents a wave travelling along $\mathrm{Y}$-axis?
1. $x=A ~sin(ky-\omega t)$
2. $y=A ~sin(kx-\omega t)$
3. $y=A ~sinky~ cos \omega t$
4. $y=A ~cosky~ sin \omega t$

64.

Two strings $A$ and $B,$ made of same material, are stretched by same tension. The radius of string $A$ is double of the radius of $B.$ A transverse wave travels on $A$ with speed $v_A$ and on $B$ with speed $v_B.$ The ratio $\frac{v_A}{v_B}=$ ?

1.	$\frac{1}{2}$	2.	$2$
3.	$\frac{1}{4}$	4.	$4$

65.

A tuning fork of frequency $480$ Hz is used to vibrate a sonometer wire having natural frequency $410$ Hz. The wire will vibrate with a frequency:

1.	$410$ Hz	2.	$480$ Hz
3.	$820$ Hz	4.	$960$ Hz

66.

Two sound waves move in the same direction in the same medium. The pressure amplitudes of the waves are equal but the wavelength of the first wave is double the second. Let the average power transmitted across cross-section by the first wave be $P_1$ and that by the second wave be $P_2.$ Then:

1.	$P_1=P_2~~~~~$	2.	$P_1=4P_2~~~~~$
3.	$P_2=2P_1$	4.	$P_2=4P_1$

67.

The fundamental frequency of a vibrating organ pipe is $200$ Hz.

a.	the first overtone is $400$ Hz.
b.	the first overtone may be $400$ Hz.
c.	the first overtone may be $600$ Hz.
d.	$600$ Hz is an overtone.

Choose the correct option:

1.	(a), (b) and (c)
2.	(b), (c) and (d)
3.	(a) and (b)
4.	all of these

68.

The first overtone of a closed organ pipe of length $l_1$ matches the fundamental frequency of an open pipe of length $l_2$. Then,
1. $l_1 = 2l_2$
2. $l_2 = 2l_1$
3. $2l_1 = 3l_2$
4. $2l_2 = 3l_1$

69.

Which statements are correct regarding centriole?

I:	Centrioles are typically made up of nine sets of short microtubule triplets, arranged in a cylinder.
II:	The main function of centrioles is to produce cilia during interphase and the aster and the spindle during cell division.
III:	Centrioles start duplicating when DNA replicates.

1.	Only I and II	2.	Only I and III
3.	Only II and III	4.	I, II and III

70.

The following reaction will be catalyzed by an enzyme classified as a/an:
A–B + H₂O → A–OH + B–H

1.	Oxidoreductase	2.	Hydrolase
3.	Lyase	4.	Transferase

71.

In the DNA double helix:

I:	At each step of ascent, the strand turns 34º.
II:	The rise per base pair would be 0.36 nm.

1.	Only I is correct
2.	Only II is correct
3.	Both I and II are correct
4.	Both I and II are incorrect

72.

The time taken by a particle performing SHM to pass from the point $\mathrm A$ to $\mathrm B$ where its velocities are same is $2$ s. After another $2$ s, it returns to point $\mathrm B.$ The time period of oscillation is:

1.	$2$ s	2.	$8$ s
3.	$6$ s	4.	$4$ s

73.

The kinetic energy $K$ for a particle executing simple harmonic motion is given by , $K=K_0\sin^2\omega t$ . The maximum value of potential energy is:

1.	$K_0$	2.	zero
3.	$K_0 \over 2$	4.	$K_0 \over 4$

74.

A body oscillates simple harmonically with a period of $2$ s starting from the origin (mean position). After what time, will its potential energy be $50$% of the total energy?

1.	$1 \over 6$ s	2.	$1 \over 4$ s
3.	$1 \over 3$ s	4.	$1 \over 12$ s

75.

Two simple pendulums of length $1$ m and $1.44$ m are at their mean position with their velocities in the same direction at some instant. After how many oscillations of bigger pendulum they will again be in the same phase?

1.	$5$	2.	$6$
3.	$7$	4.	$8$

76. In the figure are shown two strings made of same material and have the same cross- section. The pulleys are light. The wave speed of a transverse wave in the string $\mathrm{AB}$ is $v_1$ and in $\mathrm{CD}$ it is $v_2.$ Then $v_1 \over v_2$ is:

1.	$1~~~~~~~$	2.	$2~~~~~~~$
3.	$ \sqrt 2$	4.	$1 \over \sqrt 2$

77.

The transverse wave propagating through a medium is given by $y=Acos2\pi\Big[ft-\frac{x}{\lambda}\Big].$ If the maximum particle velocity of the medium is two times the velocity of the wave through the medium, then:

1.	$\lambda=3.14A~~~~~~~$	2.	$\lambda=6.28A~~~~~~~$
3.	$6.28\lambda=A$	4.	$3.14\lambda=A$

78.

$y(x,~t)=\frac{0.01}{[(4x+2t)^2+5]}$ represents a moving wave pulse, where $x$ and $y$ are in meter and $t$ is in seconds. Then which of these statement(s) is incorrect?

1.	pulse is moving in $(\mathrm{-x})$ direction.
2.	wave speed is $0.5$ m/s.
3.	maximum particle displacement is $1$ cm.
4.	it is a symmetric pulse.

79. A simple pendulum has some time period $T$. What will be the percentage change in its time period if its amplitude is decreased by $5\%$$?$

1.	$6$$\%$
2.	$3\%$
3.	$1.5\%$
4.	it will remain unchanged

80. A transverse sinusoidal wave of amplitude $a,$ wavelength $\mathit{\lambda}$ and frequency $f$ is traveling on a stretched string. The maximum speed of any point on the string is $\frac{v}{10},$ where $v$ is the speed of propagation of the wave. If $a=10^3$ m and $v=10$ ms^_-1 , then $\mathit{\lambda}$ and $f$ are given by:
1. $\mathit{\lambda}{=}\mathit{\pi}\times{10}^{{-}{2}}$ m
2. $\mathit{\lambda}{=}{10}^{{-}{3}}$ m
3. ${f}{=}{10}^{{-}{3}}{/}\left({{2}\mathit{\pi}}\right)$ Hz
4. ${f}{=}{10}^{4}$ Hz

81. Two SHMs have equations:
${x}_{1}{=}{a}\sin\left({\mathit{\omega}{t}{+}{\mathit{\phi}}_{1}}\right)$ and ${x}_{2}{=}{a}\sin\left({\mathit{\omega}{t}{+}{\mathit{\phi}}_{2}}\right)$.
If the amplitude of the resultant SHM is equal to amplitude of superimposing SHM(s), the phase difference between them is:

1.	$\frac{\mathit{\pi}}{6}$	2.	$\frac{{2}\mathit{\pi}}{3}$
3.	$\frac{\mathit{\pi}}{4}$	4.	$\frac{\mathit{\pi}}{3}$

82. Splitting of centromere occurs in:
1. Mitotic anaphase and Anaphase II
2. Mitotic anaphase and Anaphase I
3. Mitotic metaphase and Metaphase II
4. Mitotic metaphase and Metaphase I

83. Between Telophase I and Prophase II:
1. The nuclear membrane disappears
2. DNA does not replicate
3. A tetrad of cells is formed
4. There is a long lasting resting stage

84. The equation of vibration of a taut string, fixed at both ends, is given by: $y=(3~\text{mm})~\text{cos}\Big(\frac{\pi x}{10~\text{cm}}\Big)~\text{sin}(800\pi~\text{s}^{-1}~\text{t})$ The positions of the nodes are:

1.	x = 0 cm, 10 cm, 20 cm,...
2.	x = 0 cm, 20 cm, 40 cm,...
3.	x = 5 cm, 10 cm, 15 cm,...
4.	x = 5 cm, 15 cm, 25 cm,...

85. The major product of the following reaction is:

1.		2.
3.		4.

Chemistry - Section B

86. Most stable compound among the following is:

1.		2.
3.		4.

87. Which of the following does not take place during diakinesis of Meiosis I?
1. Disappearance of nucleolus
2. Decondensation of chromosomes
3. Nuclear envelope breaks down
4. Assembly of meiotic spindle

88. Meiosis in sexually reproducing organisms creates new variations by shuffling the available genetic material and leads to the formation of a recombinant DNA which is created at:
1. Pachytene of Prophase I
2. Diplotene of Prophase I
3. Anaphase I of Meiosis I
4. Anaphase II of Meiosis II

89. A string fixed at both ends is under tension $T.$ It has a length $L,$ and mass $m.$ The fundamental frequency of the vibration is:

1.	${ 1 \over 2L} \sqrt {T\over m}~~~~~~~~~~~~~~$	2.	$\frac{1}{4 L} \sqrt{\frac{T}{m}}~~~~~~~~~~~~~~$
3.	$\frac{1}{2} \sqrt{\frac{TL}{2m}}$	4.	$\frac{1}{2} \sqrt{\frac{T}{m L}}$

90. The first overtone of a closed pipe has a frequency $f_c.$ A frequency that is $2f_c$ can be excited from an open pipe of the same length but vibrating in its:

1.	$2^{\text{nd}}$ harmonic	2.	$3^{\text{rd}}$ harmonic
3.	$6^{\text{th}}$ harmonic	4.	$12^{\text{th}}$ harmonic

91. Identify the correct statement:

1.	α amino acids are substituted methanes
2.	Only triglycerides are lipids that are both macromolecules as well as polymers
3.	Cellulose forms secondary helical structures and can hold iodine molecules in the helical portion
4.	Every virus will have both DNA and RNA as its genetic material

92. Two springs are joined end-to-end and connected to a block of mass $m.$ The angular frequency $(\omega)$ of oscillation is:

1. $\sqrt{\frac{2k}{3m}}$
2. $\sqrt{\frac{3k}{2m}}$
3. $\sqrt{\frac{3k}{m}}$
4. $\sqrt{\frac{k}{3m}}$

93. Regarding enzyme catalysis, all of the following will be true except:

1.	The rate of reaction initially increases with an increase in substrate concentration
2.	It speeds up the rate of reaction by decreasing the requirement for activation energy
3.	If the associated co-factor is removed, the enzyme activity is enhanced
4.	Enzymes have an optimum temperature and pH at which they act most efficiently

94. Match the stage of Prophase I of Meiosis I given in Column I with the corresponding event in Column II and select the correct match from the codes given below:

	COLUMN I		COLUMN II
A.	Zygotene	P.	Crossing over
B.	Pachytene	Q.	Synapsis
C.	Diplotene	R.	Terminalization of chiasmata
D.	Diakinesis	S.	Appearance of chiasmata

Codes:

	A	B	C	D
1.	Q	P	S	R
2.	P	Q	S	R
3.	P	Q	R	S
4.	Q	P	R	S

95. Select the incorrect statement with reference to mitosis.
1. Splitting of centromere occurs at anaphase.
2. All the chromosomes lie at the equator at metaphase.
3. Spindle fibres attach to centromere of chromosomes.
4. Chromosomes decondense at telophase

96.

The compound obtained by addition of water to an alkyne having more than two carbons, in the presence of $HgSO_4 $ and dilute $H_2SO_4$ at 333K, is:

1.	A vicinal diol	2.	An aldehyde
3.	An alcohol	4.	A ketone

97.

Given below are two statements:

Statement I	Membrane-bound organelles of the endomembrane system coordinate cellular functions.
Statement II	Mitochondria and chloroplasts are not considered a part of the endomembrane system.

In the light of the above statements, choose the most appropriate answer from the options given below :

1.	Statement - I is correct but Statement - II is incorrect.
2.	Statement - I is incorrect but Statement - II is correct.
3.	Both Statement - I and Statement - II are correct.
4.	Both Statement - I and Statement - II are incorrect.

98. Given below are two statements:

Assertion (A):	When a spring is cut into two equal parts, the spring constant of each part of the spring is doubled.
Reason (R):	Spring constant is inversely proportional to the length of the spring.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

99. Given below are two statements:

Assertion (A):	The graph of potential energy and kinetic energy of a particle in SHM with respect to position is a parabola.
Reason (R):	Potential energy and kinetic energy do not vary linearly with position.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

100. 120 gram of an organic compound on combustion analysis gives 330 gram of carbon dioxide and 270 gram of water. % by mass of C and H in an organic compound is:
1. 50% C and 50% H
2. 60% C and 40% H
3. 80%C and 20% H
4. 75% C and 25% H

Biology - 1 - Section A

101. Given below are two statements:

Assertion (A):	The flash of lightning is seen before the sound of thunder is heard.
Reason (R):	Speed of sound is greater than speed of light.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

102. Given below are two statements:

Assertion (A):	Sound waves cannot propagate through a vacuum but light waves can.
Reason (R):	Sound waves cannot be polarised but light waves can be.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

103.

Assertion (A):	It is impractical to separate Conformers.
Reason (R):	Conformers have a negligibly small difference in their potential energy.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

104. A. Release of products of the reaction
B. Binding of substrate to the active site of the enzyme
C. Formation of enzyme-substrate complex
D. Alteration in the shape of the enzyme
E. Enzyme free to bind another molecule of substrate
Given above are the steps involved in the catalytic cycle of enzyme action. Choose the correct answer from the options given below:
1. B > C > D > A > E
2. B > D > C > A > E
3. B > D > A > E > C
4. B > E > D > C > A

105. Consider the following phases of cell cycle:

A.	S	B.	G2
C.	G1	D.	M

Choose the correct sequence of phases of the cell cycle:

1.	C, A, B, D	2.	D, B, A, C
3.	A, C, B, D	4.	C, A, D, B

106. Which of the following statement(s) is/are not correct regarding lysosomes?

A.	The hydrolytic enzymes of lysosomes are active under alkaline pH
B.	Lysosomes are membrane-bound structures
C.	Lysosomes are formed by the process of packaging in the endoplasmic reticulum
D.	Lysosomes have numerous hydrolytic enzymes

Choose the correct answer from the options given below:

1.	A only	2.	B, D Only
3.	A, D Only	4.	A, C Only

107. Which of the following combinations are correct in response to plastids?
A. Amyloplasts store carbohydrates
B. Leucoplasts gives a red colour to the plant
C. Xanthophyll gives yellow and orange colours to parts of the plant
D. Carotenoid pigments are responsible for tapping light energy
E. Chlorophyll gives a red color
Choose the correct answer from the options given below:

1.	A & B only	2.	A, C, D only
3.	A, B, C, D only	4.	A & D only

108. What happens during the metaphase stage of the cell cycle?
1. Chromosomes are moved to the spindle equator.
2. Centromere splits and chromatids separate.
3. Pairing between homologous chromosomes takes place.
4. Crossing over between homologous chromosomes takes place.

109. Which of the following is wrong with respect to 'biomolecules'?

A.	Cellulose and starch can hold I₂ due to formation of helical secondary structures
B.	Proteins transport nutrient across cell membrane and fight infectious organisms
C.	At high temperature, enzymes get damaged while inorganic catalysts work efficiently
D.	In animal tissue, different drugs, pigments, essential oil, magnesium, O₂ compounds are noticed
E.	DNA and RNA have three chemically distinct components - heterocyclic, monosaccharides and phosphates.

Choose the correct answer from the options given below:
1. D & E only
2. A & D only
3. A, B & D only
4. B, E & C only

110. Arrange the following stages of chromosomal behaviour during Prophase-I of meiosis in the correct sequence.
A. Appearance of recombination nodules
B. Formation of synaptonemal complex
C. Appearance of chiasmata
D. Terminalisation of chiasmata
E. Beginning of chromosomal compaction
Choose the correct answer from the options given below:
1. E, B, D, A, C
2. C, D, A, E, B
3. E, B, A, C, D
4. D, B, E, A, C

111. Among the following, the structure which does NOT represent 2-methyl butane is:

1.		2.
3.		4.

112. Which one of the following, most accurately describes the structure of a human haemoglobin molecule, that can bind four oxygen molecules to form oxyhaemoglobin?
1. It has a primary, tertiary and quaternary structure only.
2. It has a primary, secondary and tertiary structure only.
3. It has a primary and secondary structure only.
4. It has a primary, secondary, tertiary and quaternary structure.

113. Primary proteins are also known as polypeptides, because:
1. they are linear chains.
2. they are polymers of peptide monomers.
3. successive amino acids are joined by peptide bonds.
4. they can assume many conformations.

114. On average, a human heart is found to beat $72$ times per minute. The frequency of heartbeat will be:

1.	$0.833$ s^-1	2.	$1.2$ s^-1
3.	$12$ s^-1	4.	$72$ s^-1

115. A particle displaced by wave has its motion represented by equation, $\frac{\sin (\omega t)}{\sqrt{2}}+\frac{\cos (\omega t)}{\sqrt{2}}.$ The amplitude of the motion is:

1.	${1\over \sqrt 2}$ unit	2.	$\sqrt 2 $ unit
3.	$1$ unit	4.	$2$ unit

116. Match List-I with List-II:

	List - I		List - II
a.	F₁- F₀particles	(i)	Site of dark reaction of photosynthesis
b.	Stroma of chloroplast	(ii)	Site of glycosidation of lipids
c.	Kinetochores	(iii)	ATP synthesis
d.	Golgi bodies	(iv)	Site of attachment of spindle fibres

Choose the correct answer from the options given below
1. a(iii), b(i), c(iv), d(ii)
2. a(iii), b(ii), c(iv), d(i)
3. a(ii), b(iii), c(i), d(iv)
4. a(ii), b(iv), c(iii), d(i)

117. The given reaction is an example of:

1. Addition reaction.
2. Nucleophilic substitution reaction.
3. Electrophilic substitution reaction.
4. Electrophilic addition reaction.

118. Two vibrating tuning forks producing progressive waves given by;
$y_1=4sin(500 \pi t-K_1x),$ $y_2=2sin(506\pi t-K_2x)$ are held near the ear of a person. The person will hear:
1. $9$ beats/s
2. $6$ beats/s
3. $3$ beats/s
4. $2$ beats/s

119.

Statement I:	Addition of $Cl_2$ in the presence of $CCl_4 $ with alkene will give geminal dichloride.
Statement II:	The addition of two moles of HCl with alkyne will give vicinal dichloride.

1.	Statement I is true and statement II is false.
2.	Statement I is false and statement II is true.
3.	Both statements I and II are true.
4.	Both statements I and II are false

120. A sonometer wire supports a $5$ kg load and vibrates in fundamental mode with a tuning fork of frequency $420$ Hz. The length of the wire between the bridges is now doubled. In order to maintain fundamental mode with same frequency, the load should be changed to:

1.	$1$ kg	2.	$2$ kg
3.	$8$ kg	4.	$20$ kg

121. Select the correct match from among the following:
1. Collagen – Intracellular ground substance
2. Toxin – Codeine
3. Lectin – Ricin
4. Alkaloid – Morphine

122. Match the structures given in column I, with their names in column II and select the correct option:

	Column I		Column II
a.		(i)	Alanine
b.		(ii)	Serine
c.		(iii)	Glycine
d.		(iv)	Glycerol

1. a(iii), b(iv), c(i), d(ii)
2. a(ii), b(iv), c(iii), d(i)
3. a(i), b(iv), c(ii), d(iii)
4. a(iv), b(iii), c(ii), d(i)

123.

Assertion(A):	The acid-insoluble fraction contains lipids and proteins.
Reason(R):	The molecular weight of proteins and lipids is in the range of ten thousand daltons and above.

In the light of the above statements, select the option with the correct answer.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true, (R) is false.
4.	(A) is false, (R) is true.

124. Read the statements given below with respect to proteins and select the correct one:

1.	In proteins, only left-handed helices are observed.
2.	Adult human haemoglobin is an example of a tertiary structure.
3.	Primary structure of proteins gives the positional information of amino acids.
4.	The first amino acid in a polypeptide chain is called the C-terminal amino acid.

125. Consider the statements 'A' and 'B' and select the correct option:

Statement A:	Just like inorganic catalysts, enzymes work efficiently at high temperatures and high pressures
Statement B:	Thermal stability is an important quality of enzymes isolated from thermophilic organisms

1. Both statements A and B are correct
2. Only statement A is correct
3. Only statement B is correct
4. Both statements A and B are incorrect

126. Read the statements given below carefully:

(a)	Lipids are generally water soluble.
(b)	Dietary proteins are the source of essential amino acids.
(c)	Paper made from plant pulp and cotton fibre is cellulosic in nature.
(d)	In a nucleic acid, the bond between the phosphate and hydroxyl group of sugar is an ester bond.

How many of the statements given above are correct?

1.	One	2.	Two
3.	Three	4.	Four

127. Which of the following graphs correctly represents the effect of change in temperature on enzyme activity?

1.		2.
3.		4.

128. Read the statements given below and select the correct option:

(a)	In glycogen, the right end is the reducing one
(b)	Cellulose and starch form complex helices
(c)	Starch is the main structural component of papers made from plant pulp

1.	Statements (a) and (b) are correct while statement (c) is incorrect
2.	Statements (a) and (c) are correct while statement (b) is incorrect
3.	Statements (b) and (c) are incorrect while statement (a) is correct
4.	Statements (a) and (c) are incorrect while statement (b) is correct

129. Read the given statements carefully and select the correct one:
1. In DNA, the two strands of polynucleotides are parallel to each other.
2. The backbone is formed by the sugar, phosphate, sugar chain.
3. The nitrogen bases are projected more or less perpendicular to the backbone but face outside.
4. T and C of one strand complementarily base pairs with G and A in the other strand, respectively.

130. If guanine makes 20% of the DNA molecules, what will be the percentage of adenine, thymine and cytosine in it?
1. [A]: 20 ; [T] : 25 ; [C] : 35
2. [A]: 30 ; [T] : 30 ; [C] : 20
3. [A]: 20 ; [T] : 30 ; [C] : 30
4. [A]: 30 ; [T] : 20 ; [C] : 30

131. Which graph best represents the relationship between the wavelength and speed of waves emitted from a tuning fork, if the wave frequency is fixed?

1.		2.
3.		4.

132. Increasing the wave amplitude of a standing wave will:

1.	increase the number of nodes.
2.	increase the number of antinodes.
3.	increase the displacement of the cord at a node.
4.	increase the displacement of the cord at an antinode.

133. The IUPAC name for the following compound is:

1.	4-Hexen-3-one	2.	3-Hexenone
3.	2-Hexene-4-one	4.	Hex-3-on-4-ene

134. The wave shown in traveling to the right. Which of the waves below, traveling to the left, will momentarily cancel this wave?

1.		2.
3.		4.

135. The two lowest notes on the piano are $\mathrm{A_0}$ $(27.5~\mathrm{Hz})$ and $\mathrm{A}$#_$0$ $(29.1~\mathrm{Hz}).$ If you play the notes simultaneously, the resulting sound seems to turn off and on and off and on. How much time exists between the successive "on"s?

1.	$0.6$ s	2.	$1.6$ s
3.	$28.3$ s	4.	$56.6$ s

Biology - 1 - Section B

136. A block of mass $2$ kg is attached with two identical springs of force constant $20$ N/m as shown in the figure. The time period of the oscillation of the block is:

1. $2\pi \sqrt{\frac{1}{20}}$ s
2. $\pi \sqrt{\frac{1}{20}}$ s
3. $2\pi \sqrt{\frac{1}{10}}$ s
4. $\pi \sqrt{\frac{1}{10}}$ s

137. The incorrect statement(s) among the following is/are:

a.	The spots of colorless compounds in TLC can be detected by putting the plate under infrared light.
b.	Carbohydrate is detected by spraying the plate with ninhydrin solution.
c.	Chromatography paper contains water trapped in it, which acts as the stationary phase.

1. Only a
2. Both a and b
3. Both b and c
4. Only c

138. If the angular frequency of the given motion $y = sin ( \omega t) + cos (\omega t)$ is $k \omega$, then value of $k$ is:
1. $1/2$
2. $1$
3. $2$
4. none of these

139. Doubling of the number of chromosomes can be achieved by disrupting mitotic cell division soon after:

1.	Anaphase	2.	Telophase
3.	Prophase	4.	Metaphase

140. Which of the following statements are correct in the context of Golgi apparatus?

A.	It is the important site for the formation of glycoprotein and glycolipids
B.	It produces cellular energy in the form of ATP
C.	It modifies the protein synthesized by ribosomes on ER
D.	It facilitates the transport of ions
E.	It provides mechanical support

Choose the most appropriate answer from the options given below:

1.	(B) and (C) only	2.	(A) and (C) only
3.	(A) and (D) only	4.	(D) and (E) only

141. Given below are two statements:

Assertion (A):	It is essential for a cell to divide, to restore the nucleo-cytoplasmic ratio.
Reason (R):	Cell growth disturbs the nucleo-cytoplasmic ratio.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

142. Given below are two statements:

Assertion (A):	Meiosis does not occur in haploids cells.
Reason (R):	Haploid cells do not form gametes.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

143. Given below are two statements:

Assertion (A):	During anaphase-1 of meiosis, non-homologous chromosomes separate.
Reason (R):	There is splitting of centromere during anaphase-1.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

144. Given below are two statements:

Assertion (A):	Concentration of ions is significantly higher in the vacuole than in the cytoplasm in a plant cell.
Reason (R):	In plants, the tonoplast facilitates the transport of a number of ions against the concentration of gradient into a vacuole

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

145. Unidentical chromatids of a chromosome move to opposite poles during:
1. Anaphase II
2. Telophase
3. Mitotic anaphase
4. Anaphase I

146. Given below are two statements:

Assertion (A):	Mitochondria and chloroplasts have their own DNA.
Reason (R):	Endoplasmic reticulum and Golgi body are the cell organelles which have their own DNA.

1.	Both (A) and (R) are True and (R) is the correct explanation of (A).
2.	Both (A) and (R) are True but (R) is not the correct explanation of (A).
3.	(A) is True but (R) is False.
4.	Both (A) and (R) are False.

147. Given below are two statements:

Assertion (A):	Cell wall gives shape to the plant cell, protect the cell and helps in cell to cell interactions.
Reason (R):	Cell wall is living rigid structure, an outer covering for the plasma membrane of fungi, animal and plants.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

148. Find the odd one out for G₁ phase, from the following:
1. Most of the cell organelles duplicate here
2. Involves protein synthesis
3. Centriole duplicates in cytoplasm
4. RNA formation occurs

149. Given below are two statements:

Assertion (A):	It is important that the organisms should have cells.
Reason (R):	A cell keeps its chemical composition steady within its boundary.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

150. A cell is considered as a fundamental, structural and functional unit of all living organisms. This is because

1.	Metabolic reactions occur only inside the cell.
2.	Anything less than a complete structure of a cell does not ensure independent living.
3.	Cytoplasm is the main arena of activities, which is present inside the cell.
4.	There is no independent existence of unicelled prokaryotes as they have only a single cell.

Biology - 2 - Section A

151. Under the microscope, we cannot see chromosome in which of the following phases of cell division?
1. Leptotene
2. Anaphase
3. Diakinesis
4. Late telophase

152. Chromatophores and mesosomes are both membranous extensions into the cytoplasm but still they differ from each other as former helps in __A_ and latter helps in B .
Fill the above blanks choosing the correct option.

	A	B
1.	Respiration	Photosynthesis
2.	Cell wall formation	DNA replication
3.	Photosynthesis	Respiration
4.	DNA replication	Secretion process

153. A process that is common to metaphases of mitosis, meiosis I as well as meiosis II is:

1.	Alignment of chromosome at equatorial plate
2.	Attachment of spindle fibres from centrioles to both of the kinetochores of each chromosome
3.	Separation of sister chromatids
4.	Exchange of genetic material between non-sister chromatids

154. Carrier proteins in the membrane, facilitate the transport of water molecules because these molecules:

1.	Are polar; hence cannot pass through the lipid bilayer.
2.	Are so large that they cannot cross the lipid bilayer
3.	Are not required in the cytoplasm but only in the membrane.
4.	May be lipid-soluble but requires tunnel proteins.

155. Apart from chromoplasts, carotenoid pigments are also seen in chloroplast. There they:
1. Are responsible for trapping light energy
2. Impart colour to plant parts only
3. Can initiate photosynthesis
4. Act as primary photosynthetic pigments.

156. Mark the incorrect option about chromosomes from the following:
1. Contain DNA and histones but not RNA
2. Contain primary constriction
3. Are 23 pairs in diploid human cell
4. Are condensed forms of chromatin

157. Among the following, the compound which contains the fewest tertiary carbons is

1.	$(CH_3)_3C(CH_2)_2CH_3~~~~~~~~~~~~~$
2.	4-isobutylheptane
3.
4.

158. Given below are two statements:

Assertion (A):	Analysis of compounds gives an idea of the kind of organic and inorganic constituents of living tissue.
Reason (R):	Ash analysis is performed to identify organic components of living tissue.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

159. Given below are two statements:

Assertion (A):	Lipids are a part of acid-soluble pool.
Reason (R):	Lipids are macromolecular polymers and are insoluble in water.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

160. Given below are two statements:

Assertion (A):	Tertiary structure of a protein is absolutely necessary for its biological activities.
Reason (R):	The structure brings distant amino acid side chains closer, thereby forming active sites of enzymes.

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

161. The organic compound 'X' that is 5 - 7% of the total cellular mass in living organisms, constitutes monomeric units that are joined together with the help of:

1.	Phosphodiester bonds	2.	Peptide bonds
3.	Glycosidic bonds	4.	Hydrogen bonds

162. The cell wall of an Okra plant is made up of cellulose. The variant of this, present in plants that act as a store-house of energy is:

1.	Glycogen	2.	Glucosamine
3.	Chitin	4.	Starch

163. The enzyme commission number of an enzyme 'X' is 2.3.1.4. 'X' belongs to a class of enzymes that catalyses:
1. NAD⁺ + 2H⁺ + 2e^- $\longrightarrow$ NADH + H⁺
2. S - G + S¹ $\longrightarrow$ S + S¹ - G
3. X - C - C - Y $\longrightarrow$ X - Y + C = C
4. A - B + H₂O $\longrightarrow$ A - OH + B - H

164. Neopentyl chloride reacts with benzene in the presence of a Lewis acid ($AlCl_3$) to form:
1.

2.

3.

4.

165. What is common between Eukaryotic & Prokaryotic flagella?
1. Both have the same structure
2. Both are used for locomotion
3. Both are composed of the same proteins
4. Both are extensions of the cell membrane

166. Which of the following is similar, in the DNA of an elephant and the mango tree?

1.	Size of DNA	2.	Type of nucleotide
3.	Sequence of nucleotide	4.	Total bases

167.

The above diagram represents:
1. anaphase-I
2. metaphase-I
3. telophase-I
4. prophase-I

168. Which of the following sodium compound(s) is/are formed when an organic compound containing both nitrogen and sulphur is fused with sodium?
1. Cyanide and sulphide.
2. Thiocyanate.
3. Sulphite and cyanide.
4. Nitrate and sulphide.

169. Match List-I with List-II and select the correct answer using the codes given below:

	List I (Stability)		List II (Reason)
(A)		(1)	Inductive effect
(B)		(2)	Resonance
(C)		(3)	Hyper-conjugation and resonance
(D)		(4)	Hyper-conjugation and inductive effect

Codes:
1. A - 2; B - 3; C - 4; D - 1
2. A - 3; B - 1; C - 4; D - 2
3. A - 4; B - 3; C - 1; D - 2
4. A - 3; B - 4; C - 2; D - 1

170. Among the following, the compound which is wrongly named is:

1.		2-Chloropentanoic acid
2.		2-Methylpent-2-en-5-oic acid
3.		Hex-3-en-2-one
4.		4-Methylpentanal

171.

The major product (A) in the above reaction is:

1.		2.
3.		4.

172. The correct decreasing order of bond length in the given compound is:

1. I > III > II
2. II > I > III
3. I > II > III
4. III > II > I

173.

In the following diagrams, each shows a section of the cell surface membrane to illustrate the fluid mosaic model. Which diagram is the most accurate?
(The black shape represents cholesterol, and the gray shape represents protein.)

1.
2.
3.
4.

174. The hydrocarbon that cannot be prepared effectively by the Wurtz reaction is:
1.

2.

3.

4.

175. Which structure‐function pair is mismatched?
1. Smooth endoplasmic reticulum ‐ synthesis of lipids
2. Golgi apparatus ‐ synthesis of glycoprotein
3. Peroxisome ‐ Cellular respiration
4. Vacuole ‐ water balance

176. Which of the following reactions is correct?

1.
2.
3.
4.

177. Incorrect statement/s among the following about alkynes is:
1. The first three members are gases.
2. All alkynes are odourless.
3. All alkynes are colorless.
4. They are lighter than water and immiscible with water.

178. Select the incorrect statement from the following, regarding cell wall functions:
1. Protection from mechanical injury
2. Cell-to-cell interaction
3. Maintains shape of cell
4. Provides selective permeability

179. Animal cells and plant cells are similar to each other in all of the following features, except?
1. Cytoplasm is the main arena of cellular activities
2. Presence of a non-membranous cell organelle which helps in cell division and formation of basal bodies
3. Presence of both 70S and 80S ribosomes
4. Presence of endomembrane system

180. Which of the following is not associated with the observations of Theodore Schwann?

1.	Cell membrane is the outermost layer of animal cells.
2.	Bodies of both plants and animals are composed of cells and their products
3.	A cell divides to form new cells
4.	Presence of cell wall is a unique feature of plant cells

181. Chromosomes duplicate during __A__ and increase in number of chromosomes is observed first during __B__. Identify A & B correctly.

1	A – Interphase	B – Prophase
2	A – S – phase	B – Telophase
3	A – Synthetic phase	B – Gap 2 phase
4	A – Interphase	B – Anaphase

182. Give the stability order of the following radicals:

(I)	$\mathrm{CH}_3-\dot{\mathrm{C}} \mathrm{H}_2~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~$
(II)	$\mathrm{CH}_3-\dot{\mathrm{C}} \mathrm{H}-\mathrm{CH}_3$
(III)	$\text {CH}_2=\mathrm{CH}-\dot{\mathrm{C}} \mathrm{H}-\mathrm{CH}_3$
(IV)

1. III > IV > II > I
2. IV > III > II > I
3. I > II > III > IV
4. IV > II > III > I

183. The number of moles of hydrogen will be required for the complete hydrogenation of one mole of the following compound is:

1. 6
2. 7
3. 5
4. 3

184. The total number of unsaturated cyclic structure possible for a compound with the molecular formula C₄H₆ is:
1. 3
2. 4
3. 5
4. 6

185. Which one of the following statements is not true for carbocation?
1. Carbocation is electrophile.
2. Carbocation is diamagnetic in character.
3. It is formed by homolytic bond fission.
4. It reacts with nucleophiles.

Biology - 2 - Section B

186. The electrophile species among the following is/are:
1. $\mathrm{CO}_2$
2. $NO_2^+$
3. $\mathrm{AlCl}_3$
4. All of the above.

187. Which of the following alkenes is the most stable?
1.

2. $CH_3-CH=CH_2 $
3. $H_3C-CH=CH-CH_3 $
4.

188. The total number of possible structural isomers with the molecular formula C₅H₁₀O having either aldehyde or ketone functional group are:
1. 6
2. 4
3. 5
4. 7

189. $0.16 ~g$ of an organic substance was heated in a carius tube and the sulphuric acid formed was precipitated as- BaSO₄ with BaCl₂. The weight of the dry BaSO₄ was 0.35 g. The $\%$ of sulphur in the compound is:

1.	36.11	2.	30.04
3.	25.12	4.	42.12

190. The correct order of stability of the following carbocations is:

1. II > IV > I > III
2. I > II > III > IV
3. II > I > IV > III
4. I > III > II > IV

191. The total number of resonance structures (including the given structure) that can be drawn for the following carbocation is:

1. 0
2. 1
3. 3
4. 4

192. Arrange the following compounds in decreasing number of $\alpha -$hydrogen:


(i)	(ii)	(iii)

1. (i) > (ii) > (iii)
2. (ii) > (i) > (iii)
3. (ii) > (iii) > (i)
4. (iii) > (ii) > (i)

193. When n-hexane is heated with anhydrous $AlCl_3$ and $HCl $ gas, the major products(s) obtained is/are:
1. Mixture of 2-methylpentane and 3-methylpentane.
2. 2-chlorohexane.
3. 3-chlorohexane .
4. Hex-3-ene.

194. The correct IUPAC numbering among the following is:
1.

2.

3.

4.

195. A few mixtures and their methods of separation are given in columns I and II respectively. Match the columns and mark the appropriate choice.

	Column I		Column II
(A)	Chloroform + aniline	(p)	Steam distillation
(B)	o-Nitrophenol + p-Nitrophenol	(q)	Distillation
(C)	Benzoic acid+ Benzaldehyde	(r)	Fractional distillation
(D)	Fractions of crude oil	(s)	Sublimation

1. A-(r); B-(q); C-(p); D-(s)
2. A-(q); B-(r); C-(p); D-(s)
3. A-(q); B-(p); C-(s); D-(r)
4. A-(p); B-(r); C-(q); D-(s)

196.

	List-I (Chemicals)		List-II (Use/Preparation/Constitute)
A.	Alcoholic potassium hydroxide	(i)	Potassium salt of a carboxylic acid.
B.	Pd/BaSO₄	(ii)	Obtained by addition reaction.
C.	BHC (Benzene hexachloride)	(iii)	Used for $\beta$-elimination.
D.	Kolbe’s electrolytic method	(iv)	Lindlar's catalyst.

Choose the most appropriate match:

1. A-(ii), B-(i), C-(iv), D-(iii)
2. A-(iii), B-(iv), C-(ii), D-(i)
3. A-(iii), B-(i), C-(iv), D-(ii)
4. A-(ii), B-(iv), C-(i), D-(iii)

197. The total number of lone pair of electrons in the given molecule is:

:
1. 8
2. 6
3. 5
4. 7

198. Arrange the following in decreasing order of stability of their transition state during elimination by a strong base.

1. II > I > III
2. II > III > I
3. I > III > II
4. I > II > III

199.

Assertion (A):	Inductive effect is a permanent effect.
Reason (R):	Inductive effect weakens steadily with increasing distance from the substituent.

In light of the above statements choose the correct answer from the options given below:

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	Both (A) and (R) are false.

200. For Young's double-slit experiment, two statements are given below:

Statement I:	If screen is moved away from the plane of slits, angular separation of the fringes remains constant.
Statement Ii:	If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases.

In the light of the above statements, choose the correct answer from the options given below:

1.	Statement I is false but Statement II is true.
2.	Both Statement I and Statement II are true.
3.	Both Statement I and Statement II are false.
4.	Statement I is true but Statement II is false.

201. The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is:

1.	$3:1$	2.	$1:2$
3.	$2:1$	4.	$1:3$

202. The ratio of radius of gyration of a solid sphere of mass $M$ and radius $R$ about its own axis to the radius of gyration of the thin hollow sphere of same mass and radius about its axis is:
1. $5:2$
2. $3:5$
3. $5:3$
4. $2:5$

203. An ac source is connected to a capacitor $C$. Due to decrease in its operating frequency:

1.	capacitive reactance remains constant	2.	capacitive reactance decreases.
3.	displacement current increases.	4.	displacement current decreases.

204. In hydrogen spectrum, the shortest wavelength in the Balmer series is $\lambda$. The shortest wavelength in the Bracket series is:
1. $16\lambda$
2. $2\lambda$
3. $4\lambda$
4. $9\lambda$

205. Resistance of a carbon resistor determined from colour codes is $(22000 \pm 5 \%) ~\Omega$. The colour of third band must be:
1. Yellow
2. Red
3. Green
4. Orange

206. A vehicle travels half the distance with speed $v$ and the remaining distance with speed $2v$. Its average speed is:
1. $\frac{3v}{4}$
2. $\frac{v}{3}$
3. $\frac{2v}{3}$
4. $\frac{4v}{3}$

207. The potential energy of a long spring when stretched by $2$ cm is $U$. If the spring is stretched by $8$ cm, potential energy stored in it will be:

1.	$16U$	2.	$2U$
3.	$4U$	4.	$8U$

208. A bullet is fired from a gun at the speed of $280$ ms^-1 in the direction $30^\circ$ above the horizontal. The maximum height attained by the bullet is: ($g=9.8$ ms^-2, $\mathrm{sin}30^{0}=0.5$ )

1.	3000 m	2.	2800 m
3.	2000 m	4.	1000 m

209. The half-life of a radioactive substance is $20$ minutes. In how much time, the activity of substance drops to $(\frac{1}{16})^{\mathrm{th}}$ of its initial value?
1. $80$ minutes
2. $20$ minutes
3. $40$ minutes
4. $60$ minutes

210. The net magnetic flux through any closed surface is:
1. negative
2. zero
3. positive
4. infinity

211. A metal wire has mass $(0.4\pm 0.002)~\mathrm{g}$, radius $(0.3\pm 0.001)~\mathrm{mm}$ and length $(5\pm 0.02)~\mathrm{cm}$. The maximum possible percentage error in the measurement of density will nearly be:
1. $1.4 \%$
2. $1.2 \%$
3. $1.3 \%$
4. $1.6 \%$

212. The angular acceleration of a body, moving along the circumference of a circle, is:

1.	along the axis of rotation
2.	along the radius, away from centre
3.	along the radius towards the centre
4.	along the tangent to its position

213. The magnetic energy stored in an inductor of inductance $4~\mathrm{\mu H}$ carrying a current of $2~\text{A}$ is:
1. $8~\mathrm{\mu J}$
2. $4~\mathrm{\mu J}$
3. $4~\mathrm{mJ}$
4. $8~\mathrm{mJ}$

214. A full wave rectifier circuit consists of two $\mathrm{p-n}$ junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?

1.	load resistance	2.	a centre-tapped transformer
3.	$\mathrm{p-n}$ junction diodes	4.	capacitor

215. A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is:

1.	along south-west
2.	along eastward
3.	along northward
4.	along north-east

216. The work functions of Caesium (Cs), Potassium (K) and Sodium (Na) are $2.14$ eV, $2.30$ eV and $2.75$ eV respectively. If incident electromagnetic radiation has an incident energy of $2.20$ eV. which of these photosensitive surfaces may emit photoelectrons?

1.	Na only	2.	Cs only
3.	Both Na and K	4.	K only

217. If $\oint_s \vec{E} \cdot \overrightarrow{d S}=0$ over a surface, then:

1.	the electric field inside the surface is necessarily uniform.
2.	the number of flux lines entering the surface must be equal to the number of flux lines leaving it.
3.	the magnitude of electric field on the surface is constant.
4.	all the charges must necessarily be inside the surface.

218. Given below are two statements:

Statement I:	Photovoltaic devices can convert optical radiation into electricity.
Statement II:	Zener diode is designed to operate under reverse bias in breakdown.

In the light of the above statements, choose the correct answer from the options given below:

1.	Statement I is false but Statement II is true.
2.	Both Statement I and Statement II are true.
3.	Both Statement I and Statement II are false.
4.	Statement I is true but Statement II is false.

219. In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of $2.0\times 10^{10}~ \mathrm{Hz}$ and amplitude $48~\mathrm{Vm^{-1}}$. Then the amplitude of oscillating magnetic field is: (Speed of light in free space $3\times 10^{8}~ \mathrm{ms^{-1}}$ )
1. $1.6 \times 10^{-6} \mathrm{~T}$
2. $1.6 \times 10^{-9} \mathrm{~T}$
3. $1.6 \times 10^{-8} \mathrm{~T}$
4. $1.6 \times 10^{-7} \mathrm{~T}$

220. The temperature of a gas is $-50^\circ \mathrm{C}$. To what temperature the gas should be heated so that the rms speed is increased by $3$ times?

1.	$223$ $\mathrm{K}$	2.	$669^\circ \mathrm{C}$
3.	$3295^\circ \mathrm{C}$	4.	$3097$ $\mathrm{K}$

221. The magnitude and direction of the current in the following circuit is:

1.	$1.5$ A from B to A through E
2.	$0.2$ A from B to A through E
3.	$0.5$ A from A to B through E
4.	$\frac{5}{9}$ A from A to B through E

222. An electric dipole is placed at an angle of $30^\circ$ with an electric field of intensity $2\times 10^5 ~\mathrm{NC^{-1}}$. It experiences a torque equal to $4~\mathrm{N-m}$. Calculate the magnitude of charge on the dipole, if the dipole length is $2$ cm.

1.	$2~\mathrm{mC}$	2.	$8~\mathrm{mC}$
3.	$6~\mathrm{mC}$	4.	$4~\mathrm{mC}$

223. Let a wire be suspended from the ceiling (rigid support) and stretched by a weight $W$ attached at its free end. The longitudinal stress at any point of cross-sectional area $A$ of the wire is:
1. zero
2. $2W/A$
3. $W/A$
4. $W/2A$

224. The equivalent capacitance of the system shown in the following circuit is:

1.	$9~\mathrm{\mu F}$	2.	$2~\mathrm{\mu F}$
3.	$3~\mathrm{\mu F}$	4.	$6~\mathrm{\mu F}$

225. The venturi-meter works on:

1.	The principle of perpendicular axes
2.	Huygen's principle
3.	Bernoulli's principle
4.	The principle of parallel axes

226. A $12~\text{V},60~\text{W}$ lamp is connected to the secondary of a step down transformer, whose primary is connected to ac mains of $220~\text{V}$. Assuming the transformer to be ideal, what is the current in the primary winding?
1. $0.37 ~\mathrm{A}$
2. $0.27 ~\mathrm{A}$
3. $2.7 ~\mathrm{A}$
4. $3.7 ~\mathrm{A}$

227. In a series $\mathrm{LCR}$ circuit, the inductance $\mathrm{L}$ is $10$ mH, capacitance $\mathrm{C}$ is $1~\mathrm{\mu F}$ and resistance $\mathrm{R}$ is $100~\Omega$. The frequency at which resonance occurs is:

1.	$1.59~\mathrm{kHz}$	2.	$15.9~\mathrm{rad/s}$
3.	$15.9~\mathrm{kHz}$	4.	$1.59~\mathrm{rad/s}$

228. Two bodies of mass $m$ and $9m$ are placed at a distance $R$. The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be: ( $G$= gravitational constant)
1. $-\frac{20~GM}{R}$
2. $-\frac{8~GM}{R}$
3. $-\frac{12~GM}{R}$
4. $-\frac{16~GM}{R}$

229. Light travels a distance $x$ in time $t_1$ in air and $10x$ in time $t_2$ in another denser medium. What is the critical angle for this medium?
1. $\sin ^{-1}\left(\frac{10 t_1}{t_2}\right) $
2. $\sin ^{-1}\left(\frac{ t_2}{t_1}\right) $
3. $\sin ^{-1}\left(\frac{10 t_2}{t_1}\right) $
4. $\sin ^{-1}\left(\frac{ t_1}{10t_2}\right) $

230. The amount of energy required to form a soap bubble of radius $2~\text{cm}$ from a soap solution is nearly: $($Surface tension of soap solution $0.03~\text{Nm}^{-1})$
1. $50.1 \times 10^{-4}~\text{J}$
2. $30.16 \times 10^{-4}~ \text{J}$
3. $5.06 \times 10^{-4} ~\text{J}$
4. $3.01\times 10^{-4} ~\text{J}$

231. The minimum wavelength of X-rays produced by an electron accelerated through a potential difference of $V$ volts is proportional to:
1. $V^2$
2. $\sqrt{V}$
3. $1/V$
4. $\frac{1}{\sqrt{V}}$

232. If the galvanometer $\mathrm{G}$ does not show any deflection in the circuit shown, the value of $\mathrm{R}$ is given by:


1. $400~\Omega$
2. $200~\Omega$
3. $50~\Omega$
4. $100~\Omega$

233. A Carnot engine has an efficiency of $50\%$ when its source is at a temperature $327^\circ \mathrm{C}$. The temperature of the sink is:
1. $200^\circ \mathrm{C}$
2. $27^\circ \mathrm{C}$
3. $15^\circ \mathrm{C}$
4. $100^\circ \mathrm{C}$

234. The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are:
1. Random errors
2. Instrumental errors
3. Personal errors
4. Least count errors

235. A wire carrying a current $I$ along the positive x-axis has length $L$. It is kept in a magnetic field $\vec{B}=(2 \hat{i}+3 \hat{j}-4 \hat{k})$ T. The magnitude of the magnetic force acting on the wire is:
1. $\sqrt{3}IL$
2. $3IL$
3. $\sqrt{5}IL$
4. $5IL$

236. A very long conducting wire is bent in a semi-circular shape from $A$ to $B$ as shown in the figure. The magnetic field at point $P$ for steady current configuration is given by:

1.	$\frac{\mu_0 i}{4 R}\left[1-\frac{2}{\pi}\right]$ pointed into the page
2.	$\frac{\mu_0 i}{4 R}$ pointed into the page
3.	$\frac{\mu_0 i}{4 R}$ pointed away from the page
4.	$\frac{\mu_0 i}{4 R}\left[1-\frac{2}{\pi}\right]$ pointed away from the page

237. A bullet from a gun is fired on a rectangular wooden block with velocity $u$. When bullet travels $24$ cm through the block along its length horizontally, velocity of bullet becomes $u/3$. Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is:
1. $30$ cm
2. $27$ cm
3. $24$ cm
4. $28$ cm

238. An electric dipole is placed as shown in the figure.

The electric potential (in $10^2~V$) at point $P$ due to the dipole is($\epsilon_0$= permittivity of free space and $\frac{1}{4 \pi \epsilon_0}=k$):
1. $(\frac{8}{3})qk$
2. $(\frac{3}{8})qk$
3. $(\frac{5}{8})qk$
4. $(\frac{8}{5})qk$

239. In the figure shown here, what is the equivalent focal length of the combination of lenses? (Assume that all layers are thin)

1. $-50~\mathrm{cm}$
2. $40~\mathrm{cm}$
3. $-40~\mathrm{cm}$
4. $-100~\mathrm{cm}$

240. A satellite is orbiting just above the surface of the earth with period $T.$ If d is the density of the earth and $G$ is the universal constant of gravitation, the quantity $\frac{3 \pi}{G d}$ represents:
1. $\sqrt{T}$
2. $T$
3. $T^2$
4. $T^3$

241. $10$ resistors, each of resistance $R$ are connected in series to a battery of $E$ and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased $n$ times. The value of $n$ is:

1.	$1000$	2.	$10$
3.	$100$	4.	$1$

242. A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity $4$ ms^-1. The ball strikes the water surface after $4$ s. The height of bridge above water surface is: (Take $g=$$10$ ms^-2 )
1. $68$ m
2. $56$ m
3. $60$ m
4. $64$ m

243. Two thin lenses are of same focal lengths ($f$), but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be:
1. Infinite
2. zero
3. $f/4$
4. $f/2$

244. The radius of inner most orbit of hydrogen atom is $5.3 \times 10^{-11}$ m. What is the radius of third allowed orbit of hydrogen atom?

1.	$4.77~ \mathring{\text{A}}$	2.	$0.53~ \mathring{\text{A}}$
3.	$1.06~ \mathring{\text{A}}$	4.	$1.59~ \mathring{\text{A}}$

245. The resistance of platinum wire at $0^{\circ} \mathrm{C}$ is $2~ \Omega$ and $6.8~ \Omega$ at $80^{\circ}$. The temperature coefficient of resistance of the wire is:

1.	$3 \times 10^{-1}~{ }^{\circ} \mathrm{C}^{-1}$	2.	$3 \times 10^{-4}~{ }^{\circ} \mathrm{C}^{-1}$
3.	$3 \times 10^{-3}~{ }^{\circ} \mathrm{C}^{-1}$	4.	$3 \times 10^{-2}~{ }^{\circ} \mathrm{C}^{-1}$

246. The net impedance of circuit (as shown in the figure) will be:

1. $25~\Omega$
2. $10\sqrt{2}~\Omega$
3. $15~\Omega$
4. $5\sqrt{5}~\Omega$

247. Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is $0.15$ (Take $g=10$ ms^-2).

1.	$50$ ms^-2	2.	$1.2$ ms^-2
3.	$150$ ms^-2	4.	$1.5$ ms^-2

248. For the following logic gate, the truth table is:

1.

A	B	Y
0	0	0
0	1	0
1	0	0
1	1	1

2.

A	B	Y
0	0	1
0	1	1
1	0	1
1	1	0

3.

A	B	Y
0	0	0
0	1	1
1	0	1
1	1	1

4.

A	B	Y
0	0	1
0	1	0
1	0	1
1	1	0

249. The $x-t$ graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at $t=2$ s is:

1.	$-\frac{\pi^2}{16} \mathrm{~ms}^{-2}$	2.	$\frac{\pi^2}{8} \mathrm{~ms}^{-2}$
3.	$-\frac{\pi^2}{8} \mathrm{~ms}^{-2}$	4.	$\frac{\pi^2}{16} \mathrm{~ms}^{-2}$

250. The mass of CO₂ produced by heating 20 g of 20% pure limestone
as per the given below equation is:
$\left[\mathrm{CaCO}_3 \stackrel{1200 \mathrm{~K}}{\longrightarrow} \mathrm{CaO}+\mathrm{CO}_2\right] $

1.	1.32 g	2.	1.12 g
3.	1.76 g	4.	2.64 g

251. Some tranquilizers are listed below. Which one from the following belongs to barbiturates?

1.	Veronal	2.	Chlordiazepoxide
3.	Meprobamate	4.	Valium

252. Given below are two statements: one is labeled as Assertion (A) and the other is labeled as Reason (R):

Assertion (A):	Helium is used to dilute oxygen in the diving apparatus.
Reason (R):	Helium has a high solubility in O₂.

In the light of the above statements choose the correct answer from the options given below:

1.	(A) is false but (R) is true.
2.	Both (A) and (R) are true and (R) is the correct explanation of (A).
3.	Both (A) and (R) are true and (R) is NOT the correct explanation of (A).
4.	(A) is true but (R) is false.

253. Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R):

Assertion (A):	Metallic sodium dissolves in liquid ammonia giving a deep blue solution, which is paramagnetic.
Reason (R):	The deep blue solution is due to the formation of amide.

In the light of the above statements choose the correct answer from the options given below:

1.	(A) is false but (R) is true.
2.	Both (A) and (R) are true and (R) is the correct explanation of (A).
3.	Both (A) and (R) are true and R is NOT the correct explanation of (A).
4.	(A) is true but (R) is false.

254. The correct order of energies of molecular orbitals of N₂ molecule is:

1.	$ \sigma \text { 1s }<\sigma^* \text { 1s }<\sigma 2 s<$ $\sigma^* 2 s<\left(\pi 2 p_x=\pi 2 p_y\right)<$ $\left(\pi^* 2 p_x=\pi^* 2 p_y\right)<\sigma 2 p_z<\sigma^* 2 p_z$
2.	$ \sigma \text { 1s }<\sigma^* \text { 1s }<\sigma 2 s<\sigma^* 2 s<$ $\left(\pi 2 p_x=\pi 2 p_y\right)< $ $\sigma 2 p_z<\left(\pi^* 2 p_x=\pi^* 2 p_y\right)<\sigma^* 2 p_z $
3.	$ \sigma \text { 1s }<\sigma^* \text { 1s }<\sigma 2 s<\sigma^* 2 s<\sigma 2 p_z<$ $ \left(\pi 2 p_x=\pi 2 p_y\right)<$ $\left(\pi^* 2 p_x=\pi^* 2 p_y\right)<\sigma^* 2 p_z $
4.	$ \sigma \text { 1s }<\sigma^* \text { 1s }$ $<\sigma 2 s<\sigma^* 2 s<\sigma 2 p_z< $ $ \sigma^* 2 p_z<\left(\pi 2 p_x=\pi 2 p_y\right)<$ $\left(\pi^* 2 p_x=\pi^* 2 p_y\right) $

255. Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R):

Assertion (A):	A reaction can have zero activation energy.
Reason (R):	The minimum extra amount of energy absorbed by reactant molecules so that their energy becomes equal to threshold value, is called activation energy.

In the light of the above statements choose the correct answer from the options given below:

1.	Both (A) and (R) are true and (R) is the correct explanation of (A).
2.	Both (A) and (R) are true but (R) is not the correct explanation of (A).
3.	(A) is true but (R) is false.
4.	(A) is false but (R) is true.

256. Weight (g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in the presence of calcium oxide is:
1. 18
2. 16
3. 32
4. 30

257. Complete the following reaction:

[C] is:

1.		2.
3.		4.

258. Select the correct statements from the following:

A.	Atoms of all elements are composed of two fundamental particles.
B.	The mass of the electron is $9.10939 \times 10^{-31} \mathrm{~kg} \text {. }$.
C.	All the isotopes of a given element show same chemical properties.
D.	Protons and electrons are collectively known as nucleons.
E.	Dalton's atomic theory regarded the atom as an ultimate particle of matter.

Choose the correct answer from the option given below:

1.	B, C and E only	2.	A, B and C only
3.	C, D and E only	4.	A and E only

259. The stability of Cu²⁺ is greater than that of Cu⁺ salts in an aqueous solution due to:
1. Second ionisation enthalpy
2. First ionisation enthalpy
3. Enthalpy of atomization
4. Hydration energy

260. The relation between $n_m $ ($n_m $ = number of permissible values of magnetic quantum number (m_l) for a given value of azimuthal
quantum number (l) is:
1. $n_m = l+2$
2. $l = {n_m -1 \over 2}$
3. $l= 2n_m +I$
4. $n_m = 2l^2 + I$

261. Intermolecular forces are forces of attraction and repulsion between interacting particles that will be:

A.	dipole - dipole forces
B.	dipole-induced dipole forces
C.	hydrogen bonding
D.	covalent bonding
E.	dispersion forces

Choose the most appropriate answer from the options given below:
1. A, C, D, E are correct
2. B, C, D, E are correct
3. A, B, C, D, E are correct
4. A, B, C, E are correct

262. Homoleptic complex from the following complexes is:
1. Triamminetriaquachromium (III)
2. Potassium trioxalatoaluminate (III)
3. Diamminechloridonitrito-N-platinum (II)
4. Pentaamminecarbonatocobalt (III) chloride

263. Which of the following reactions will NOT give primary amine as the product?

1.
2.
3.
4.

264. Which one of the following statements is correct?

1.	Mg plays role in neuromuscular function and interneuronal transmission.
2.	The daily requirement of Mg and Ca in the human body is estimated to be 0.2-0.3 g.
3.	All enzymes that utilize ATP in phosphate transfer require Ca as the cofactor.
4.	The bone in the human body is an inert and unchanging substance.

265. Amongst the given option which of the following molecules/ion acts as a Lewis acid?

1.	$OH^- $	2.	$NH_3 $
3.	$H_2O $	4.	$BF_3 $

266. Which amongst the following options is correct graphical representation of Boyle's Law?

1.		2.
3.		4.	-

267.

Match the allotropes of cabon given in List I with the respective characteristics given in List II.

List-I		List-II
A.	Coke	I.	Carbon atoms are sp³hybridised.
B.	Diamond	II.	Used as a dry lubricant
C.	Fullerene	III.	Used as a reducing agent
D.	Graphite	IV.	Cage like molecules

Choose the correct answer from the options given below:

Options:	(A)	(B)	(C)	(D)
1.	III	IV	I	II
2.	II	IV	I	III
3.	IV	I	II	III
4.	III	I	IV	II

268. The element expected to form the largest ion to achieve the nearest
noble gas configuration is:
1. Na
2. O
3. F
4. N

269. Given below are two statements:

Statement I:	A unit formed by the attachment of a base to 1' position of sugar is known as a nucleoside.
Statement II:	When nucleoside is linked to phosphorous acid at 5' position of sugar moiety we get nucleotide.

In the light of the above statements choose the correct answer from the options given below:

1.	Statement I is false but Statement II is true.
2.	Both Statement I and Statement II are true.
3.	Both Statement I and Statement II are false.
4.	Statement I is true but Statement II is false.

270. Which one is an example of heterogeneous catalysis?

1.	Combination between dinitrogen and dihydrogen to form ammonia in the presence of finely divided iron.
2.	Oxidation of sulphur dioxide into sulphur trioxide in the presence of oxides of nitrogen.
3.	Hydrolysis of sugar catalysed by H⁺ ions.
4.	Decomposition of ozone in presence of nitrogen monoxide.

271. The given compound

is an example of:

1.	Vinylic halide	2.	Benzylic halide
3.	Aryl halide	4.	Allylic halide

272. In Lassaigne's extract of an organic compound both nitrogen and sulphur are present which gives blood red colour with $Fe^{3+}$ due to the formation of-
1. $[\mathrm{Fe}(\mathrm{SCN})]^{2+} $
2. $\mathrm{Fe}_4\left[\mathrm{Fe}(\mathrm{CN})_6\right]_3 \cdot \times \mathrm{H}_2 \mathrm{O} $
3. $\mathrm{NaSCN} $
4. $\left[\mathrm{Fe}(\mathrm{CN})_5 \mathrm{NOS}\right]^{4-} $

273. Which amongst the following molecules on polymerization produces neoprene?

1.		2.
3.		4.

274. Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R):

Assertion (A):	In equation $\Delta_{\mathrm{r}} \mathrm{G}=-\mathrm{nFE} _{\text {cell }}, $ value $\Delta_rG $ depends on n.
Reason (R):	$E_{cell} $ is an intensive property and $\Delta_rG $ is an extensive property.

In the light of the above statements choose the correct answer from the options given below:

1.	(A) is false but (R) is true.
2.	Both (A) and (R) are true and (R) is the correct explanation of (A).
3.	Both (A) and (R) are true and (R) is NOT the correct explanation of (A).
4.	(A) is true but (R) is false.

275. A compound is formed by two elements A and B. The element B forms cubic close-packed structure and atoms of A occupy 1/3 of tetrahedral voids. If the formula of the compound is $A_x B_y $ then the value of x+y is in option
1. 2
2. 5
3. 4
4. 3

276. Amongst the following, the total number of species NOT having eight electrons around the central atom in its outermost shell, is:
$\mathrm{NH}_3, \mathrm{AlCl}_3, \mathrm{BeCl}_2, \mathrm{CCl}_4, \mathrm{PCl}_5 $

1.	1	2.	3
3.	2	4.	4

277. Which of the following statements is NOT correct?

A.	Hydrogen is used to reduce heavy metal oxides to metals.
B.	Heavy water is used to study the reaction mechanism.
C.	Hydrogen is used to make saturated fats from oils.
D.	The H-H bond dissociation enthalpy is lowest as compared to a single bond between two atoms of any element.
E.	Hydrogen reduces oxides of metals that are more active than iron.

Choose the most appropriate answer from the options given below:

1.	A, B, C only	2.	B, C, D, E only
3.	B, D only	4.	D, E only

278. Identify the product in the following reaction:

1.		2.
3.		4.

279. The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm^-1cm^-1and the resistance of the cell containing the solution at 25°C is 60 ohm. The value of cell constant is-

1.	3.34 cm^-1	2.	1.34 cm^-1
3.	3.28 cm^-1	4.	1.26 cm^-1

280. The number of $\sigma$ bonds, $\pi$ bonds and lone pair of electrons in pyridine respectively are:
1. 12, 2, 1
2. 11, 2, 0
3. 12, 3, 0
4. 11, 3, 1

281. Identify the correct relationship of stability from the options provided.

1. $TlI > TlI_3$
2. $TlCl_3 > TlCl$
3. $InI_3 > InI $
4. $AlCl > AlCl_3 $

282. Identify the product (A) in the following reaction:

1.
2.
3.
4.

283. For a certain reaction, the rate = $k[A]^2[B],$ when the initial concentration of A is tripled keeping the concentration of B constant, the initial rate would be:
1. increase by a factor of three
2. decrease by a factor of nine
3. increase by a factor of six
4. increase by a factor of nine

284. Consider the following reaction and identify the product (P).

1.		2.
3.		4.

285. Which amongst the following options is the correct relation between change in enthalpy and change in internal energy ?
1. $\Delta \mathrm{H}+\Delta \mathrm{U}=\Delta \mathrm{nR} $
2. $\Delta \mathrm{H}=\Delta \mathrm{U}-\Delta n_gRT$
3. $\Delta \mathrm{H}=\Delta \mathrm{U}+\Delta n_gRT $
4. $\Delta \mathrm{H} -\Delta \mathrm{U}=-\Delta n_gRT$

286. The equilibrium concentration of the species in the reaction $A+B \rightleftharpoons C+D$ are 2, 3, 10 and 6 mol L^-1, respectively at 300 K .$\Delta G^o$ for the reaction is: (R = 2 cal/mol K)

1.	-13.73 cal	2.	1372.60 cal
3.	-137.26 cal	4.	-1381.80 cal

287. Identify the major product obtained in the following reaction:

1.		2.
3.		4.

288. Pumice stone is an example of-

1.	foam	2.	sol
3.	gel	4.	solid sol

289. On balancing the given redox reaction,
$\mathrm{a} \mathrm{Cr}_2 \mathrm{O}_7^{2-}+\mathrm{bSO}_3^{2-}(\mathrm{aq})+\mathrm{c} \mathrm{H}^{+}(\mathrm{aq}) \rightarrow$
$2 \mathrm{a} \mathrm{Cr}^{3+}(\mathrm{aq})+\mathrm{bSO}_4^{2-}(\mathrm{aq})+\frac{\mathrm{c}}{2} \mathrm{H}_2 \mathrm{O}(\ell) $
the coefficients a, b, and c are found to be, respectively:

1.	8, 1, 3	2.	1, 3, 8
3.	3, 8, 1	4.	1, 8, 3

290. What fraction of one edge centred octahedral void lies in one unit cell of fcc?

1.	$ 1 \over 12$	2.	$ 1 \over 2$
3.	$ 1 \over 3$	4.	$ 1 \over 4$

291. Given below are two statements:

Statement I:	The nutrient deficient water bodies lead to eutrophication.
Statement II:	Eutrophication leads to decrease in the level of oxygen in the water bodies.

In the light of the above statements choose the correct answer from the options given below:
1. Statement I is incorrect but Statement II is true.
2. Both Statement I and Statement II are true.
3. Both Statement I and Statement II are false.
4. Statement I is correct but Statement II is false.

292. Which amongst the following will be most readily dehydrated under acidic conditions?

1.		2.
3.		4.

293. Match the Oxoacids of Sulphur given in column I with the number of bond given in column II and mark the correct option.

List-I(Oxoacids of Sulphur)		List-II(Bonds)
A.	Peroxodisulphuric acid	I.	Two S-OH, Four S=O, One S-O-S
B.	Sulphuric acid	II.	Two S-OH, One S=O
C.	Pyrosulphuric acid	III.	Two S-OH, Four S=O, One S-O-O-S
D.	Sulphurous acid	IV.	Two S-OH, Two S=O

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	III	IV	II	I
2.	I	III	II	IV
3.	III	IV	I	II
4.	I	III	IV	II

294. Identify the final product [D] obtained in the following sequence of reactions.

1.		2.
3.		4.	C₄H₁₀

295. Which complex compound is most stable?
1. [Co(NH₃)₆]₂(SO₄)₃
2. [Co(NH₃)₄(H₂O)Br](NO₃)₂
3. [Co(NH₃)₃(NO₃)₃]
4. [CoCl₂(en)₂]NO₃

296. Consider the following reaction:

Identify products A and B.

1.
2.
3.
4.

297. Which of the following statements is INCORRECT?

A.	All the transition metals except scandium form MO oxides which are ionic.
B.	The highest oxidation number corresponding to the group number on transition metal oxides is attained in Sc₂O₃ to Mn₂O₇.
C.	Basic character increases from V₂O₃ to V₂O₄ to V₂O₅.
D.	V₂O₄ dissolves in acids to give VO₄^3-.
E.	CrO is basic but Cr₂O₃ is amphoteric.

Choose the correct answer from the options given below:

1.	B and C only	2.	A and E only
3.	B and D only	4.	C and D only

298. Consider the following compounds/species:

i.		ii.
iii.		iv.
v		vi
vii

The number of compounds/species which obey Huckel's rule is-

1.	5	2.	4
3.	6	4.	2

299. The reaction that does not take place in a blast furnace between 900 K to 1500 K temperature range during the extraction of iron is:
1. CaO + SiO₂ → CaSiO₃
2. Fe₂O₃ + CO → 2FeO + CO₂
3. FeO + CO → Fe +CO₂
4. C + CO₂ → 2CO

300. Which micronutrient is required for splitting of water molecule during photosynthesis?

1.	Copper	2.	Manganese
3.	Molybdenum	4.	Magnesium

301. Unequivocal proof that DNA is the genetic material was first proposed by:
1. Wilkins and Franklin
2. Frederick Griffith
3. Alfred Hershey and Martha Chase
4. Avery, Macleoid and McCarthy

302. Give below are two statements :

Statement I:	Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body.
Statement II:	Exarch condition is the most common feature of the root system.

In the light of the above statements, choose the correct answer from the options given below:
1. Statement I is incorrect but Statement II is true.
2. Both Statement I and Statement II are true.
3. Both Statement I and Statement II are false.
4. Statement I is correct but Statement II is false.

303. Cellulose does not form blue colour with Iodine because

1.	It breaks down when iodine reacts with it.
2.	It is a disaccharide.
3.	It is a helical molecule.
4.	It does not contain complex helices and hence cannot hold iodine molecules.

304. Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.

1.	Epiphyllous and Dithecous anthers
2.	Diadelphous and Dithecous anthers
3.	Polyadelphous and epipetalous stamens
4.	Monoadelphous and Monothecous anthers

305. The reaction centre in PS II has an absorption maxima at:

1.	780 nm	2.	680 nm
3.	700 nm	4.	660 nm

306. Upon exposure to UV radiation, DNA stained with ethidium bromide will show:

1.	Bright orange colour	2.	Bright red colour
3.	Bright Blue colour	4.	Bright yellow colour

307. The phenomenon of pleiotropism refers to:

1.	more than two genes affecting a single character.
2.	presence of several alleles of a single gene controlling a single crossover.
3.	presence of two alleles, each of the two genes controlling a single trait.
4.	a single gene affecting multiple phenotypic expressions.

308. The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year :

1.	2002	2.	1985
3.	1992	4.	1986

309. During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out:

1.	Polysaccharides	2.	RNA
3.	DNA	4.	Histones

310. Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by:

1.	Henking	2.	Thomas Hunt Morgan
3.	Sutton and Boveri	4.	Alfred Sturtevant

311. Give below are two statements : One is labelled as Assertion (A) and the other is labelled Reason (R) :

Assertion (A):	The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason (R):	Protonema develops directly from spores produced in capsule.

In the light of the above statements, choose the most appropriate answer from the options given below:

1.	(A) is not correct but (R) is correct.
2.	Both (A) and (R) are correct and (R) is the correct explanation of (A).
3.	Both (A) and (R) are correct but (R) is NOT the correct explanation of (A).
4.	(A) is correct but (R) is not correct.

312. Among eukaryotes, replication of DNA takes place in:

1.	G₂Phase	2.	M phase
3.	S phase	4.	G₁ phase

313. What is the function of tassels in the corn cob?

1.	To protect seeds	2.	To attract insects
3.	To trap pollen grains	4.	To disperse pollen grains

314. In the equation

GPP is Gross Primary Productivity NPP is net Primary Productivity R here is ___________
1. Reproductive allocation
2. Photosynthetically active radiation
3. Respiratory quotient
4. Respiratory loss

315. Which hormone promotes internode/petiole elongation in deep water rice?

1.	2, 4-D	2.	GA₃
3.	Kinetin	4.	Ethylene

316. Axile placentation is observed in:
1. China rose, Petunia and Lemon
2. Mustard, Cucumber and Primrose
3. China rose, Beans and Lupin
4. Tomato, Dianthus and Pea

317. The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?

1.	Diakinesis	2.	Zygotene
3.	Pachytene	4.	Diplotene

318. The thickness of ozone in a column of air in the atmosphere is measured in terms of :

1.	Kilobase	2.	Dobson unit
3.	Decibels	4.	Decameter

319. Given below are two statements:

Statement I:	The forces generated by transpiration can lift a xylem-sized column of water over 130 meters height.
Statement II:	Transpiration cools leaf surfaces sometimes 10 to 15 degrees, by evaporative cooling.

In light of the above statements, choose the most appropriate answer from the options given below :
1. Statement I is incorrect but Statement II is correct
2. Both Statement I and Statement II are correct.
3. Both Statement I and Statement II are incorrect.
4. Statement I is correct but Statement II is incorrect.

320. Which of the following stages of meiosis involves division of centromere?

1.	Telophase	2.	Metaphase I
3.	Metaphase II	4.	Anaphase II

321. Identify the correct Statements :

A.	Detrivores perform fragmentation.
B.	The humus is further degraded by some microbes during mineranlization.
C.	Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching.
D.	The detritus food chain begins with living organisms.
E.	Earthworms break down detritus into smaller particles by a process called catabolism.

Choose the correct answer from the options given below :

1.	D, E, A only	2.	A, B, C only
3.	B, C, D only	4.	C, D, E only

322. In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :

1.	Synergids, antipodals and Polar nuclei
2.	Synergids, Primary endosperm nucleus and zygote
3.	Antipodals, synergids, and primary endosperm nucleus
4.	Synergids, Zygote and Primary endosperm nucleus

323. Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?
1. Co-extinctions
2. Habitat loss and fragmentation
3. Over exploitation for economic gain
4. Alien species invasions

324. In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as

1.	Senescence	2.	Differentiation
3.	Dedifferentiation	4.	Development

325. In gene gun method used to introduce alien DNA into host cells, microparticles of ___________ metal are used.

1.	Silver	2.	Copper
3.	Zinc	4.	Tungsten or gold

326. Large, Colorful, fragrant flowers with nectar are seen in:

1.	wind pollinated plants	2.	insect pollinated plants
3.	bird pollinated plants	4.	bat pollinated plants

327. Expressed Sequence Tags (ESTs) refers to:
1. Certain important expressed genes.
2. All genes that are expressed as RNA.
3. All genes that are expressed as proteins.
4. All genes whether expressed or unexpressed

328. Movement and accumulation of ions across a membrane against their concentration gradient can be explained by:

1.	Active Transport	2.	Osmosis
3.	Facilitated Diffusion	4.	Passive Transport

329. Given below are two statements : One is labelled as Assertion (A) and the other is labelled as Reason (R):

Assertion (A):	ATP is used at two steps in glycolysis .
Reason (R):	First ATP is used in converting glucose into glocose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphoshate.

In the light of the above statements, choose the correct answer from the options given below :

1.	(A) is false but (R) is true.
2.	Both (A) and (R) are true and (R) is the correct explanation of (A).
3.	Both (A) and (R) are true but (R) is NOT the correct explanation of (A).
4.	(A) is true but (R) is false.

330. Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?

1.	Abscisic Acid	2.	Indole-3-butyric Acid
3.	Gibberellic Acid	4.	Zeatin

331. Identify the pair of heterosporous pteridophytes among the following :
1. Equisetum and Salvinia
2. Lycopodium and Selaginella
3. Selaginella and Salvinia
4. Psilotum and Salvinia

332. Give below are two statements : One is labelled as Assertion (A) and The other is labelled as Reason (R) :

Assertion (A):	Late wood has fewer xylary elements with narrow vessels.
Reason (R):	Cambium is less active in winters.

In the light of the above statements, choose the correct answer from the option given below :

1.	(A) is false but (R) is true.
2.	Both (A) and (R) are true and (R) is the correct explanation of (A).
3.	Both (A) and (R) are true but (R) is NOT the correct explanation of (A).
4.	(A) is true but (R) is false

333. What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
1. Transcription of only snRNAs
2. Transcription of rRNAs (28S, 18S and 5.8S)
3. Transcription of tRNA, 5 srRNA and snRNA
4. Transcription of precursor of mRNA

334. How many ATP and NADPH₂ are required for the synthesis of one molecule of Glucose during Calvin cycle?

1.	18 ATP and 16 NADPH₂	2.	12 ATP and 12 NADPH₂
3.	18 ATP and 12 NADPH₂	4.	12 ATP and 16 NADPH₂

335. Match List I with List II

	List I		List II
A.	Iron	I.	Synthesis of auxin
B.	Zinc	II.	Component of nitrate reductase
C.	Boron	III.	Activator of catalase
D.	Molybdenum	IV	Cell elongation and differentiation

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	II	IV	I	III
2.	III	II	I	IV
3.	II	III	IV	I
4.	III	I	IV	II

336. How many different proteins does the ribosome consist of?

1.	20	2.	80
3.	60	4.	40

337. Match List I with List II

	List I		List II
A.	Oxidative decarboxylation	I.	Citrate synthase
B.	Glycolysis	II.	Pyruvate dehydrogenase
C.	Oxidative phosphorylation	III.	Electron transport system
D.	Tricarboxylic acid cycle	IV.	EMP pathway

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	II	IV	III	I
2.	III	IV	II	I
3.	II	IV	I	III
4.	III	I	II	IV

338. Match List I with List II

	List I (Interaction)		List II (Species A and B
A.	Mutualism	I.	+(A), O(B)
B.	Commensalism	II.	-(A), O(B)
C.	Amensalism	III.	+(A), -(B)
D.	Parasitism	IV	+(A), +(B)

Choose the correct answer from the options given below :

Options:	A	B	C	D
1.	III	I	IV	II
2.	IV	II	I	II
3.	IV	I	II	III
4.	IV	III	I	II

339. Given below are two statements:

Statement I:	Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually.
Statement II:	In general, carnivores are more adversely affected by competition than herbivores.

In the light of the above statements, choose the correct answer from the options given below:
1. Statement I is incorrect but Statement II is true.
2. Both Statement I and Statement. II are true.
3. Both Statement I and Statement II are false.
4. Statement I is correct but Statement II is false.

340. Identify the correct statements:

A.	Lenticels are the lens-shaped openings permitting the exchange of gases.
B.	Bark formed early in the season is called hard bark.
C.	Bark is a technical term that refers to all tissues exterior to vascular cambium.
D.	Bark refers to periderm and secondary phloem.
E.	Phellogen is single- layered in thickness.

Choose the correct answer from the options given below:

1.	B and C only	2.	B, C and E only
3.	A and D only	4.	A, B and D only

341. Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.

A.	Insertion of recombinant DNA into the host cell.
B.	Cutting of DNA at specific location by restriction enzyme.
C.	Isolation of desired DNA fragment.
D.	Amplification of gene of interest using PCR.

Choose the correct answer from the options given below:

1.	B, D, A, C	2.	B, C, D, A
3.	C, A, B, D	4.	C, B, D, A

342. Given below are two statements: One is labelled as Assertion (A) and the other is labelled as
Reason (R):

Assertion (A):	In gymnosperms the pollen grains are released from the microsporangium and carried by air currents.
Reason (R):	Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed.

In the light of the above statements, choose the correct answer from the options given below:

1.	(A) is false but (R) is true.
2.	Both (A) and (R) are true and (R) is the .correct explanation of (A).
3.	Both (A) and (R) are true but (R) is NOT the correct explanation of (A).
4.	(A) is true but (R) is false.

343. Which one of the following statements is NOT correct?

1.	The amount of some toxic substances of industrial wastewater increases in the organisms at successive trophic levels.
2.	The micro-organisms involved in biodegradation of organic matter in a sewage-polluted water body consume aquatic organisms.
3.	Algal blooms caused by excess of organic matter in water improve water quality and promote fisheries.
4.	Water hyacinth grows abundantly in eutrophic water bodies and lead to an imbalance in the ecosystem dynamics of the water body.

344. Which of the following statements are correct about klinefelter's Syndrome?

A.	This disorder was first described by Langdon Down (1866).
B.	Such an individual has overall masculine development. However, the feminine development is also expressed.
C.	The affected individual is short statured.
D.	Physical, psychomotor and mental development is retarded.
E.	Such individuals are sterile.

Choose the correct answer from the options given below:

1.	A and E only	2.	A and B only
3.	C and D only	4.	B and E only

345. Given below are two statements. Other is labelled as Assertion (A) and the other is labelled as Reason (R):

Assertion (A):	A flower is defined as modified shoot wherein the shoot apical meristem changes to floral meristem.
Reason (R):	Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves.

In the light of the above statements, choose the correct answer from the options given below:

1.	(A) is false but (R) is true.
2.	Both (A) and (R) are true and (R) is the correct explanation of (A).
3.	Both (A) and (R) are true but R is NOT the correct explanation of (A).
4.	(A) is true but (R) is false.

346. Match List I with List II

	List I		List II
A.	M Phase	I.	Proteins are synthesized
B.	G₂ Phase	II.	Inactive phase
C.	Quiescent stage	III.	Interval between mitosis and initiation of DNA replication
D.	G₁ Phase	IV.	Equational division

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	II	IV	I	III
2.	III	II	IV	I
3.	IV	II	I	III
4.	IV	I	II	III

347. Malonate inhibits the growth of pathogenic bacteria by inhibiting the activity of:

1.	Dinitrogenase	2.	Succinic dehydrogenase
3.	Amylase	4.	Lipase

348. Which of the following combinations is required for chemiosmosis?

1.	Proton pump, electron gradient, NADP synthase.
2.	Membrane, proton pump, proton gradient, ATP synthase.
3.	Membrane, proton pump, proton gradient, NADP synthase
4.	Proton pump, electron gradient, ATP synthase

349. Match List I with List II

	List I		List II
A.	Cohesion	I.	More attraction in liquid phase
B.	Adhesion	II.	Mutual attraction among water molecules
C.	Surface tension	III.	Water loss in liquid phase
D.	Guttation	IV.	Attraction towards polar surfaces

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	II	I	IV	III
2.	II	IV	I	III
3.	IV	III	II	I
4.	III	I	IV	II

350. Broad palm with single palm crease is visible in a person suffering from-

1.	Thalassemia	2.	Down's syndrome
3.	Turner's syndrome	4.	Klinefelter's syndrome

351. Given below are two statements:

Statement I:	Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat.
Statement II:	When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor

In the light of the above statements, choose the correct answer from the options given below:
1. Statement I is false but Statement II is true.
2. Both Statement I and Statement II are true.
3. Both Statement I and Statement II are false.
4. Statement I is true but Statement II is false.

352. Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?

1.	HIV Infection	2.	Genital herpes
3.	Gonorrhoea	4.	Hepatitis-B

353.

Given below are two statements:

I:	Electrostatic precipitator is most widely used in thermal power plant.
II:	Electrostatic precipitator in thermal power plant removes ionising radiations

1.	Statement I is incorrect but Statement II is correct.
2.	Both Statement I and Statement II are correct.
3.	Both Statement I and Statement II are incorrect.
4.	Statement I is correct but Statement II is incorrect.

354. Given below are two statements:

Statement I:	Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct.
Statement II:	The cavity of the cervix is called cervical canal which along with vagina forms birth canal.

In light of the above statements, choose the correct answer from the options given below:
1. Statement I is incorrect but Statement II is true.
2. Both Statement I and Statement II are true.
3. Both Statement I and Statement II are false.
4. Statement I is correct but Statement II is false.

355. Which one of the following symbols represents mating between relatives in human pedigree analysis?

1.		2.
3.		4.

356. Match List I with List II.

	List I		List II
A.	Taenia	I.	Nephridia
B.	Paramoecium	II.	Contractile vacuole
C.	Periplaneta	III.	Flame cells
D.	Pheretima	IV.	Urecose gland

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	II	I	IV	III
2.	I	II	III	IV
3.	I	II	IV	III
4.	III	II	IV	I

357. Given below are two statements:

Statement I:	In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid.
Statement II:	In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome.

In the light of the above statements, choose the correct answer from the options given below:
1. Statement I is incorrect but Statement II is true.
2. Both Statement I and Statement II are true.
3. Both Statement I and Statement II are false.
4. Statement I is correct but Statement II is false.

358. Which of the following functions is carried out by the cytoskeleton in a cell?

1.	Transportation	2.	Nuclear division
3.	Protein synthesis	4.	Motility

359. Given below are two statements:

Statement I:	Ligaments are dense irregular tissue.
Statement II:	Cartilage is dense regular tissue.

In the light of the above statements, choose the correct answer from the options given below:
1. Statement I is false but Statement II is true.
2. Both Statement I and Statement II are true.
3. Both Statement I and Statement II are false.
4. Statement I is true but Statement II is false.

360. Which of the following are NOT considered as the part of endomembrane system?
A. Mitochondria
B. Endoplasmic Reticulum
C. Chloroplasts
D. Golgi complex
E. Peroxisomes
Choose the most appropriate answer from the options given below:

1.	A, D and E only	2.	B and D only
3.	A, C and E only	4.	A and D only

361. Given below are two statements: one is labelled as Assertion (A) and the other is labelled s Reason (R).

Assertion (A):	Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme.
Reason (R):	Ban on amniocentesis checks increasing menace of female foeticide.

In the light of the above statements, choose the correct answer from the options given below:

1.	(A) is False but (R) is True.
2.	Both (A) and (R) Are True and (R) is the correct explanation of (A).
3.	Both (A) and (R) are True and (R) is not the correct explanation of (A).
4.	(A) is True but (R) is False.

362. Given below are statements: one is labelled as Assertion (A) and the other is labelled as Reason (R).

Assertion (A):	Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla.
Reason (R):	Juxta medullary nephrons have short-loop of Henle whereas, cortical nephrons have longer loop of Henle.

In the light of the above statements, choose the correct answer from the options given below:

1.	(A) is false but (R) is true.
2.	Both (A) and (R) are true and (R) is the correct explanation of (A).
3.	Both (A) and (R) are true but (R) is NOT the correct explanation of (A).
4.	(A) s true but (R) is false.

363. Match List I with List II

	List I (Type of Joint)		List II (Found between)
A.	Cartilaginous Joint	I.	Between flat skull bones
B.	Ball and Socket Joint	II.	Between adjacent vertebrae in vertebral column
C.	Fibrous Joint	III.	Between carpal and metacarpal of thumb
D.	Saddle Joint	IV.	Between Humerus and Pectoral girdle

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	II	IV	III	I
2.	III	I	II	IV
3.	II	IV	I	III
4.	I	IV	III	II

364. Vital capacity of lung is

1.	IRV + ERV + TV	2.	IRV + ERV
3.	IRV + ERV + TV + RV	4.	IRV + ERV + TV - RV

365. Match List I with List iI

	List I		List II
A.	Ringworm	I.	Haemophilus influenza
B.	Filariasis	II.	Trichophyton
C.	Malaria	III.	Wuchereria bancrofti
D.	Pneumonia	IV.	Plasmodium vivax

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	III	II	IV	I
2.	II	III	IV	I
3.	II	III	I	IV
4.	III	II	I	IV

366. In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?

1.	Eosinophils	2.	T_Hcells
3.	B-lymphocytes	4.	Basophils

367. Match List I with List II

	List I		List II
A.	A. Gene 'a'	I.	$\beta$-galactosidase
B.	B. Gene 'y'	II.	Transacetylase
C.	C. Gene 'i'	III.	Permease
D.	D. Gene 'z'	IV.	Repressor protein

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	III	I	IV	II
2.	II	I	IV	III
3.	II	III	IV	I
4.	III	IV	I	II

368. Match List I with List II with respect to human eye.

	List I		List II
A.	Fovea	I	Visible coloured portion of eye that regulates diameter of pupil.
B.	Iris	II.	External layer of eye formed of dense connective tissue.
C.	Blind spot	III.	Point of greatest visual acuity or resolution.
D.	Sclera	IV.	Point where optic nerve leaves the eyeball and photoreceptor cells are absent.

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	II	I	III	IV
2.	III	I	IV	II
3.	IV	III	II	I
4.	I	IV	III	II

369. Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
1. Lemur, Anteater, Wolf
2. Tasmanian wolf, Bobcat, Marsupial mole
3. Numbat, Spotted cuscus, Flying phalanger
4. Mole, Flying squirrel, Tasmanian tiger cat

370. Which of the following statements are correct regarding female reproductive cycle?

A.	In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
B.	First menstrual cycle begins at puberty and is called menopause.
C.	Lack of menstruation may be indicative of pregnancy.
D.	Cyclic menstruation extends between menarche and menopause.

Choose the most appropriate answer from the options given below:

1.	A, C and D only	2.	A and D only
3.	A and B only	4.	A, B and C only

371. Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R).

Assertion (A):	Endometrium is necessary for implantation of blastocyst.
Reason (R):	In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium.

In the light of the above statements, choose the correct answer from, the options given below:

1.	(A) is false but (R) is true.
2.	Both (A) and (R) are true and (R) is the correct explanation of (A).
3.	Both (A) and (R) are true but (R) is NOT the correct explanation of (A).
4.	(A) is true but (R) is false.

372. Match List I with List II

	List I		List II
A.	Heroin	I.	Effect on cardiovascular system
B.	Marijuana	II.	Slow down body function
C.	Cocaine	III.	Painkiller
D.	Morphine	IV.	Interfere with transport of dopamine

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	III	IV	I	II
2.	II	I	IV	III
3.	I	II	III	IV
4.	IV	III	II	I

373. Which of the following is not a cloning vector?

1.	Probe	2.	BAC
3.	YAC	4.	_PBR322

374. Which of the following statements is correct?

1.	Algal Bloom decreases fish mortality.
2.	Eutrophication refers to increase in domestic sewage and waste water in lakes.
3.	Biomagnification refers to increase in concentration of the toxicant at successive trophic levels.
4.	Presence of large amounts of nutrients in water restricts 'Algal Bloom'.

375. Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?

1.	Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
2.	Recombinant DNA Technology
3.	Serum and Urine analysis
4.	Polymerase Chain Reaction (PCR) technique

376. Given below are two statements:

Statement I:	RNA mutates at a faster rate.
Statement II:	Viruses having RNA genome and shorter life span mutate and evolve faster.

In the light of the above statements, choose the correct answer from the options given below:

1.	Statement I is false but Statement II is true.
2.	Both Statement I and Statement II are true.
3.	Both Statement I and Statement II are false.
4.	Statement I is true but Statement II is false.

377. Match List I with List II

	List I		List II
A.	CCK	I.	Kidney
B.	GIP	II.	Heart
C.	ANF	III.	Gastric gland
D	ADH	IV.	Pancreas

Choose the correct answer from the options given below:

Options:	(a)	(b)	(c)	(d)
1.	IV	II	III	I
2.	IV	III	II	I
3.	III	II	IV	I
4.	II	IV	I	III

378. Match List I with List II

List I (Cells)	List II (Secretion)
A. Peptic cells	I. Mucus
B. Goblet cells	II. Bile juice
C. Oxyntic cells.	III. Proenzyme pepsinogen
D. Hepatic cells	IV. HCl and intrinsic factor for absorption of vitamin B₁₂

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	II	IV	I	III
2.	IV	III	II	I
3.	II	I	III	IV
4.	III	I	IV	II

379. Given below are two statements:

Statement I:	A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal).
Statement II:	Adult human haemoglobin, consists of 4 subunits (two subunits of $\alpha$ type and two subunits of ẞ type.)

In the light of the above statements, choose the correct answer from the options given below:

1.	Statement I is false but Statement II is true.
2.	Both Statement I and Statement II are true.
3.	Both Statement I and Statement II are false.
4.	Statement I is true but Statement II is false.

380. Match List I with List II

	List I (Interacting species)		List II (Name of Interaction)
A.	A Leopard and a Lion in a Forest/ grassland	I.	Competition
B.	A Cuckoo laying an egg in a Crow's nest	II.	Brood parasitism
C.	Fungi and root of a higher plant mycorrhizae	I.	Mutualism
D.	A cattle egret and a Cattle in a field	IV.	Commensalism

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	II	III	I	IV
2.	I	II	III	IV
3.	I	II	IV	III
4.	III	IV	I	II

381. Once the undigested and unabsorbed substances enter the caecum, their backflow is prevented by-

1.	Pyloric sphincter	2.	Sphincter of Oddi
3.	Ileo - caecal valve	4.	Gastro-oesophageal sphincter

382. Match List I with List II

	List I		List II
A.	P-wave	I.	Beginning of systole
B.	Q-wave	II.	Repolarisation of ventricles
C.	QRS complex	III.	Depolarisation of atria
D.	T-wave	IV.	Depolarisation of ventricles

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	I	II	III	IV
2.	III	I	IV	II
3.	IV	III	II	I
4.	II	IV	I	II

383. Radial symmetry is NOT found in adults of phylum__________

1.	Echinodermata D	2.	Ctenophora
3.	Hemichordata	4.	Coelenterata

384. Match List I with List II

	List I		List II
A.	Vasectomy	I.	Oral method
B.	Coitus interruptus	II.	Barrier method
C.	Cervical caps	III.	Surgical method
D.	Saheli	IV.	Natural method

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	IV	II	I	III
2.	III	I	IV	II
3.	III	IV	II	I
4.	II	III	I	IV

385. Which of the following statements are correct?

A:	Basophils are most abundant cells of the total WBCs.
B:	Basophils secrete histamine, serotonin and heparin.
C:	Basophils are involved in inflammatory response.
D:	Basophils have kidney shaped nucleus.
E:	Basophils are agranulocytes.

Choose the correct answer from the options given below:

1.	A and B only	2.	D and E only
3.	C and E only	4.	B and C only

386. Select the correct statements.

A.	Tetrad formation is seen during Leptotene.
B.	During Anaphase, the centromeres split and chromatids separate.
C.	Terminalization takes place during Pachytene.
D.	Nucleolus, Golgi complex and ER are reformed during Telophase.
E.	Crossing over takes place between sister chromatids of homologous chromosome.

Choose the correct answer from the options given below:

1.	B and E only	2.	A and C only
3.	B and D only	4.	A, C and E only

387. Select the correct statements with reference to chordates.

A.	Presence of a mid-dorsal, solid and double nerve cord.
B.	Presence of closed circulatory system.
C.	Presence of paired pharyngeal gill slits
D.	Presence of dorsal heart.
E.	Triploblastic pseudocoelomate animals.

Choose the correct answer from the options given below:

1.	C, D and E only	2.	A, C and D only
3.	B and C only	4.	B, D and E only

388. Which of the following statements are correct regarding skeletal muscle?

A.	Muscle bundles are held together by collagenous connective tissue layer called fascicle.
B.	Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
C.	Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins.
D.	M line is considered as functional unit of contraction called sarcomere.

Choose the most appropriate answer from the options given below:

1.	C and D only	2.	A, B and C only
3.	B and C only	4.	A, C and D only

389. Given below are two-statements:

Statement I:	During G₀ phase of cell cycle, the cell is metabolically inactive.
Statement II:	The centrosome undergoes duplication during S phase of interphase.

In the light of the above statements, choose the most appropriate answer from the options given below:

1.	Statement I is incorrect but Statement II is correct.
2.	Both Statement I and Statement II are correct.
3.	Both Statement I and Statement I are incorrect.
4.	Statement I is correct but Statement II is incorrect.

390. Which one of the following is NOT an advantage of inbreeding?

1.	It decreases the productivity of inbred population, after continuous inbreeding.
2.	It decreases homozygosity.
3.	It exposes harmful recessive genes that are eliminated by selection.
4.	Elimination of less desirable genes and accumulation of superior genes takes place due to it.

391. Which of the following statements are correct?

A.	An excessive loss of body fluid from the body switches off osmoreceptors.
B.	ADH facilitates water reabsorption to prevent diuresis.
C.	ANF causes vasodilation.
D.	ADH causes increase in blood pressure.
E.	ADH is responsible for decrease in GFR.

Choose the correct answer from the options given below:

1.	C, D and E only	2.	A and B only
3.	B, C and D only	4.	A, B and E only

392. Which of the following are NOT under the control of thyroid hormone?

A.	Maintenance of water and electrolyte balance.
B.	Regulation of basal metabolic rate.
C.	Normal rhythm of sleep-wake cycle.
D.	Development of immune system.
E.	Support the process of R.B.Cs formation.

Choose the correct answer from the options given below:

1.	D and E only	2.	A and D only
3.	B and C only	4.	C and D only

393. The parts of human brain that helps in regulation of sexual behavior, expression of excitement, pleasure, rage, fear etc: are:
1. Corpus callosum and thalamus
2. Limbic system & hypothalamus
3. Corpora quadrigeminal & hippocampus
4. Brain stem & epithalamus

394. Match List I with List II.

	List I		List II
A.	Logistic growth	I.	Unlimited resource availability condition
B.	Exponential growth	II.	Limited resource availability condition
C.	Expanding age pyramid	III.	The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups
D.	Stable age pyramid	IV.	The percent individuals of pre-reproductives and reproductive age group are same

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	II	IV	III	I
2.	II	I	III	IV
3.	II	III	I	IV
4.	II	IV	I	III

395. Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
1. 3' ATCGATCGATCGATCGATCGATCGATCG 5'
2. 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
3. 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'
4. 5' ATCGATCGATCGATCGATCGATCGATCG 3'

396. Which of the following is the characteristic
feature of cockroach regarding sexual dimorphism?
1. Presence of anal cerci
2. Dark brown body colour and anal cerci
3. Presence of anal styles
4. Presence of sclerites

397. Match List I with List II.

	List I		List II
A.	Mast cells	I.	Ciliated epithelium
B.	Inner surface of bronchiole	II.	Areolar connective tissue
C.	Blood	III.	Cuboidal epithelium
D.	Tubular parts of nephron	IV.	specialised connective tissue

Choose the correct answer from the options given below:

Options:	A	B	C	D
1.	III	IV	II	I
2.	I	II	IV	III
3.	II	III	I	IV
4.	II	I	IV	III

398. The unique mammalian characteristics are:
1. pinna, monocondylic skull and mammary glands
2. hairs, tympanic membrane and mammary glands
3. hairs, pinna and mammary glands
4. hairs, pinna and indirect development

399. In Cockroach, excretion is brought about by:

A.	Phallic gland
B.	Urecose gland
C.	Nephrocytes
D.	Fat body
E.	Collaterial glands

Choose the correct answer from the options given below:

1.	B and D only	2.	A and E only
3.	A, B and E only	4.	B, C and D only

Fill OMR Sheet*

*If above link doesn't work, please go to test link from where you got the pdf and fill OMR from there

CLICK HERE to get FREE ACCESS for 2 days of ANY NEETprep course

1.	\(\frac{T}{2}\)	2.	\(\frac{T}{3}\)
3.	\(\frac{T}{12}\)	4.	\(\frac{T}{6}\)

a.	\(\vec{F} \times \vec{a}~~~~~~~\)
b.	\(\vec{v} \times\vec{r}\)
c.	\(\vec{a} \times\vec{r}\)
d.	\(\vec{F} \times\vec{r}\)

1.	\(P_1=P_2~~~~~\)	2.	\(P_1=4P_2~~~~~\)
3.	\(P_2=2P_1\)	4.	\(P_2=4P_1\)

a.	the first overtone is \(400\) Hz.
b.	the first overtone may be \(400\) Hz.
c.	the first overtone may be \(600\) Hz.
d.	\(600\) Hz is an overtone.

1.	\(1 \over 6\) s	2.	\(1 \over 4\) s
3.	\(1 \over 3\) s	4.	\(1 \over 12\) s

1.	\(1~~~~~~~\)	2.	\(2~~~~~~~\)
3.	\( \sqrt 2\)	4.	\(1 \over \sqrt 2\)

1.	\(\lambda=3.14A~~~~~~~\)	2.	\(\lambda=6.28A~~~~~~~\)
3.	\(6.28\lambda=A\)	4.	\(3.14\lambda=A\)

1.	pulse is moving in \((\mathrm{-x})\) direction.
2.	wave speed is \(0.5\) m/s.
3.	maximum particle displacement is \(1\) cm.
4.	it is a symmetric pulse.

1.	\(\frac{\mathit{\pi}}{6}\)	2.	\(\frac{{2}\mathit{\pi}}{3}\)
3.	\(\frac{\mathit{\pi}}{4}\)	4.	\(\frac{\mathit{\pi}}{3}\)

1.	\({ 1 \over 2L} \sqrt {T\over m}~~~~~~~~~~~~~~\)	2.	\(\frac{1}{4 L} \sqrt{\frac{T}{m}}~~~~~~~~~~~~~~\)
3.	\(\frac{1}{2} \sqrt{\frac{TL}{2m}}\)	4.	\(\frac{1}{2} \sqrt{\frac{T}{m L}}\)

1.	\(1.47\) Hz	2.	\(0.36\) Hz
3.	\(0.73\) Hz	4.	\(2.94\) Hz

1.	\(2\sqrt{2}\)	2.	\(2\)
3.	\(4\)	4.	\(8\)

1.	\(5\) Hz	2.	\(10\) Hz
3.	\(40\) Hz	4.	\(20\) Hz

1.	\(3\)	2.	\(7\)
3.	\(2\)	4.	\(5\)

1.	\(2^{\text{nd}}\) harmonic	2.	\(3^{\text{rd}}\) harmonic
3.	\(6^{\text{th}}\) harmonic	4.	\(12^{\text{th}}\) harmonic

1.	\({1\over \sqrt 2}\) unit	2.	\(\sqrt 2 \) unit
3.	\(1\) unit	4.	\(2\) unit

Statement I:	Addition of \(Cl_2\) in the presence of \(CCl_4 \) with alkene will give geminal dichloride.
Statement II:	The addition of two moles of HCl with alkyne will give vicinal dichloride.

1.	\((CH_3)_3C(CH_2)_2CH_3~~~~~~~~~~~~~\)
2.	4-isobutylheptane
3.
4.

(I)	\(\mathrm{CH}_3-\dot{\mathrm{C}} \mathrm{H}_2~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\)
(II)	\(\mathrm{CH}_3-\dot{\mathrm{C}} \mathrm{H}-\mathrm{CH}_3\)
(III)	\(\text {CH}_2=\mathrm{CH}-\dot{\mathrm{C}} \mathrm{H}-\mathrm{CH}_3\)
(IV)

1.	load resistance	2.	a centre-tapped transformer
3.	\(\mathrm{p-n}\) junction diodes	4.	capacitor

1.	\(223\) \(\mathrm{K}\)	2.	\(669^\circ \mathrm{C}\)
3.	\(3295^\circ \mathrm{C}\)	4.	\(3097\) \(\mathrm{K}\)

1.	\(1.5\) A from B to A through E
2.	\(0.2\) A from B to A through E
3.	\(0.5\) A from A to B through E
4.	\(\frac{5}{9}\) A from A to B through E

1.	\(2~\mathrm{mC}\)	2.	\(8~\mathrm{mC}\)
3.	\(6~\mathrm{mC}\)	4.	\(4~\mathrm{mC}\)

1.	\(9~\mathrm{\mu F}\)	2.	\(2~\mathrm{\mu F}\)
3.	\(3~\mathrm{\mu F}\)	4.	\(6~\mathrm{\mu F}\)

Please be patient as the PDF generation may take upto a minute.

Fill OMR Sheet*

1.	\(1.59~\mathrm{kHz}\)	2.	\(15.9~\mathrm{rad/s}\)
3.	\(15.9~\mathrm{kHz}\)	4.	\(1.59~\mathrm{rad/s}\)

1.	\(\frac{\mu_0 i}{4 R}\left[1-\frac{2}{\pi}\right]\) pointed into the page
2.	\(\frac{\mu_0 i}{4 R}\) pointed into the page
3.	\(\frac{\mu_0 i}{4 R}\) pointed away from the page
4.	\(\frac{\mu_0 i}{4 R}\left[1-\frac{2}{\pi}\right]\) pointed away from the page

1.	\(4.77~ \mathring{\text{A}}\)	2.	\(0.53~ \mathring{\text{A}}\)
3.	\(1.06~ \mathring{\text{A}}\)	4.	\(1.59~ \mathring{\text{A}}\)

1.	\(3 \times 10^{-1}~{ }^{\circ} \mathrm{C}^{-1}\)	2.	\(3 \times 10^{-4}~{ }^{\circ} \mathrm{C}^{-1}\)
3.	\(3 \times 10^{-3}~{ }^{\circ} \mathrm{C}^{-1}\)	4.	\(3 \times 10^{-2}~{ }^{\circ} \mathrm{C}^{-1}\)

1.	\(-\frac{\pi^2}{16} \mathrm{~ms}^{-2}\)	2.	\(\frac{\pi^2}{8} \mathrm{~ms}^{-2}\)
3.	\(-\frac{\pi^2}{8} \mathrm{~ms}^{-2}\)	4.	\(\frac{\pi^2}{16} \mathrm{~ms}^{-2}\)

1.	\( \sigma \text { 1s }<\sigma^* \text { 1s }<\sigma 2 s<\) \(\sigma^* 2 s<\left(\pi 2 p_x=\pi 2 p_y\right)<\) \(\left(\pi^* 2 p_x=\pi^* 2 p_y\right)<\sigma 2 p_z<\sigma^* 2 p_z\)
2.	\( \sigma \text { 1s }<\sigma^* \text { 1s }<\sigma 2 s<\sigma^* 2 s<\) \(\left(\pi 2 p_x=\pi 2 p_y\right)< \) \(\sigma 2 p_z<\left(\pi^* 2 p_x=\pi^* 2 p_y\right)<\sigma^* 2 p_z \)
3.	\( \sigma \text { 1s }<\sigma^* \text { 1s }<\sigma 2 s<\sigma^* 2 s<\sigma 2 p_z<\) \( \left(\pi 2 p_x=\pi 2 p_y\right)<\) \(\left(\pi^* 2 p_x=\pi^* 2 p_y\right)<\sigma^* 2 p_z \)
4.	\( \sigma \text { 1s }<\sigma^* \text { 1s }\) \(<\sigma 2 s<\sigma^* 2 s<\sigma 2 p_z< \) \( \sigma^* 2 p_z<\left(\pi 2 p_x=\pi 2 p_y\right)<\) \(\left(\pi^* 2 p_x=\pi^* 2 p_y\right) \)

A.	Atoms of all elements are composed of two fundamental particles.
B.	The mass of the electron is \(9.10939 \times 10^{-31} \mathrm{~kg} \text {. }\).
C.	All the isotopes of a given element show same chemical properties.
D.	Protons and electrons are collectively known as nucleons.
E.	Dalton's atomic theory regarded the atom as an ultimate particle of matter.

Assertion (A):	In equation \(\Delta_{\mathrm{r}} \mathrm{G}=-\mathrm{nFE} _{\text {cell }}, \) value \(\Delta_rG \) depends on n.
Reason (R):	\(E_{cell} \) is an intensive property and \(\Delta_rG \) is an extensive property.

1.	\( 1 \over 12\)	2.	\( 1 \over 2\)
3.	\( 1 \over 3\)	4.	\( 1 \over 4\)